Online life science pharma marketplace and platform for products and services.

 

Current location: Home » Ask » Molecular biology » Content

Design two mutant primers for the following sequence and sug

Pending answer Credit reward to answer the question: 0 -
More information:
'C' at position 486 should be changed to 'T' in the following sequence
1 gatcccagaaagcattgtgccatgaggatgaacatgcagagagcagccgggaggggtcca


61 aagtattaccttggtgattaattattgattctgcctgcaagaaccaagccacagtaccca


121 tattcattaagttcaaatggaattcaggctctaaagccttaactctacctctgtctagct


181 ttaaggatggggagcaaagctctgcagtgtgaactgcactgagactgacctgcaatgttc


241 aatcctgcttctctgatatccaggctctgcacgctgcctctcttgtcccctgctcccacc


301 tgtgacaagactgagattgccagctccctcctacttccctctgctcagccctctgccatt


361 cagggtccctggaggccctactctctccctggtagtcccccaaactcttcccaagctgct


421 cttctgggttactctgccctggcagttttgtcctggatgacctccgccaacattctgtgg


481 acttacgatatgtggtccttcagaccgagggctccatccccacttctacagtcatcatca


541 acgaggccagcggcagccgcaccattctgcacgcctacaggtttgtacacctgtctgctc

601 tgcgctttgctagctgctgcctcggccatcactatactgcactctccagacaggaccctt


661 cttctctgaggcccatgtgctccaaagcacccttcccactcccagaggagatctaggcta


721 tgtgtaactctaatctgtgtttccttgccctctccctggctcgggtccctcccccaaagc



total 531 hits     Asked by: Anonymouse I want to answer  


[ AskSearch ]  [ ]  [ Tell a friend ]  [ Print ]  [ Close window ]  [ Return to top ]