Y box binding protein 1 (YBX1)

Name: YBX1
Description: Y box binding protein 1
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 1
GeneticSource: genomic
MapLocation: 1p34
OtherAliases: BP-8, CSDA2, CSDB, DBPB, MDR-NF1, MGC104858, MGC110976, MGC117250, NSEP-1, NSEP1, YB-1, YB1
OtherDesignations: DNA-binding protein B|major histocompatibility complex, class II, Y box-binding protein I|nuclease sensitive element binding protein 1
NomenclatureSymbol: YBX1
NomenclatureName: Y box binding protein 1
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 25233
Summary:
ChrSort: 01
ChrStart: 43148065

UniProtein db: YBX1 UniProt protein knowledge database
Ensembl db: YBX1 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for YBX1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: YBX1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGATGGAGGGTGCTGACAAC
Reverse primer: CCTGCGGAATCGTGGTCTAT
Probe:
Amplicon:
Annealing temperature: 60

YBX1 news
Related resources on YBX1