Y box binding protein 1 (YBX1)
Name: YBX1
Description: Y box binding protein 1
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 1
GeneticSource: genomic
MapLocation: 1p34
OtherAliases: BP-8, CSDA2, CSDB, DBPB, MDR-NF1, MGC104858, MGC110976, MGC117250, NSEP-1, NSEP1, YB-1, YB1
OtherDesignations: DNA-binding protein B|major histocompatibility complex, class II, Y box-binding protein I|nuclease sensitive element binding protein 1
NomenclatureSymbol: YBX1
NomenclatureName: Y box binding protein 1
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 25233
Summary:
ChrSort: 01
ChrStart: 43148065
UniProtein db: YBX1 UniProt protein knowledge database
Ensembl db: YBX1 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for YBX1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: YBX1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGATGGAGGGTGCTGACAAC
Reverse primer: CCTGCGGAATCGTGGTCTAT
Probe:
Amplicon:
Annealing temperature: 60
Complete information for YBX1 gene (protein-coding), Y box binding protein 1
"Entrez Gene: YBX1 Y box binding protein 1". http://www.ncbi.nlm.nih. ... Two human genes isolated by a novel method encode DNA-binding proteins containing a ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
Mouse Ybx1 Chr4:118950586-118967209 bp, - strand has data for genome coordinates, ...
ybx1 - Y box binding protein 1 - Bioportfolio ... (YBX1), which belongs to a family of cold-shock proteins, is multifunctional and appears to regulate gene ...
YBX1 also up regulates genes associated with cell proliferation. ... YBX1 binds RNAs sequence specific manner and interacts with splicing factors and plays ...
Gene expression in the mouse brain for the gene Ybx1, also known as 'Y box protein 1'
YBX1 - Y box binding protein 1 - Bioportfolio ... (YBX1), which belongs to a family of cold-shock proteins, is multifunctional and appears to regulate gene ...
YBX1: Y box binding protein 1. Species: H.sapiens. Entrez Gene ID: 4904 ... an email alert whenever other plasmids containing this gene become available, click here. ...
YBX1 antibodies. Print Friendly Email. Plasmid 13035: pRSET YBX-1. Gene/insert name: YBX1 ... YBX1, YB1, BP-8, CSDB, DBPB, YB-1, CSDA2, NSEP1, NSEP-1, MDR-NF1, ...
293 cell lysates (2 ug/lane) either nontransfected (Lane 1) or transiently transfected with the YBX1 gene (Lane 2) (Origene Technologies). Product Citations: ...
Abgent develops powerful tools to profile posttranslational modifications related to ... 1) or transiently transfected with the YBX1 gene (Lane 2) (Origene Technologies) ...
Gene: YBX1. Transcript: YBX1-201. Transcript-based displays. Transcript ... is a product of gene ENSG00000065978 - There are 5 transcripts in this gene: ...
Gene: YBX1. Y box binding protein 1. Overview. Related Genes. Pathways ... curated publications that mention this gene along with other genes is available. ...
Gene Symbol: YBX1. Number of Transcript Variants. 0. Visualize Pathways ... PMut. SNPEffect. FASTSNP YBX1. 8001 Redwood Blvd. Novato, CA 94945. Phone: 415-209-2000. Fax: ...