von Hippel-Lindau tumor suppressor (VHL)

Name: VHL
Description: von Hippel-Lindau tumor suppressor
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 3
GeneticSource: genomic
MapLocation: 3p26-p25
OtherAliases: HRCA1, RCA1, VHL1
OtherDesignations: elongin binding protein
NomenclatureSymbol: VHL
NomenclatureName: von Hippel-Lindau tumor suppressor
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 91632
Summary: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq]
ChrSort: 03
ChrStart: 10183318

UniProtein db: VHL UniProt protein knowledge database
Ensembl db: VHL Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for VHL
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: CGCCGCATCCACAGCTA
Reverse primer: GGCTTCAGACCGTGCTATCG
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: CAATGTTGACGGACAGCCTATTT
Reverse primer: GTCTATCCTGTACTTACCACAACAACCT
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: GACCTGGAGCGGCTGACA
Reverse primer: TACCATCAAAAGCTGAGATGAAACA
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTGCCCGTATGGCTCAACTT
Reverse primer: GTGTGTCCCTGCATCTCTGAAG
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: TCCCAGGTCATCTTCTGCAAT
Reverse primer: GCTCGCCGTCGAAGTTGA
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: GGTCACCTTTGGCTCTTCAGA
Reverse primer: TGAGAGATGGCACAAATAATTCAGT
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: AGAGCGATGCCTCCAGGTT
Reverse primer: CTGACGATGTCCAGTCTCCTGTAAT
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: CATCGTCAGGTCGCTCTACGA
Reverse primer: GTCAGCCGCTCCAGGTCTT
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: GGACATCGTCAGGTCGCTCTA
Reverse primer: CTTCAATCTCCCATCCGTTGA
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: GCCTCGGCCTCCCAAA
Reverse primer: ATCGGGACAAGCAAAGGTTGT
Probe:
Amplicon:
Annealing temperature: 60

Application: VHL DNA Copy Number Quantification/Detection SYBR Green I PCR
Forward primer: CCGGAGGGCGGAGAACT
Reverse primer: GTCTTCTTCAGGGCCGTACTCTT
Probe:
Amplicon:
Annealing temperature: 60

VHL news
Related resources on VHL