transforming growth factor, beta-induced, 68kDa (TGFBI)
Name: TGFBI
Description: transforming growth factor, beta-induced, 68kDa
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 5
GeneticSource: genomic
MapLocation: 5q31
OtherAliases: BIGH3, CDB1, CDG2, CDGG1, CSD, CSD1, CSD2, CSD3, EBMD, LCD1
OtherDesignations: RGD-containing collagen-associated protein|kerato-epithelin
NomenclatureSymbol: TGFBI
NomenclatureName: transforming growth factor, beta-induced, 68kDa
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 44016
Summary: This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq]
ChrSort: 05
ChrStart: 135364583
UniProtein db: TGFBI UniProt protein knowledge database
Ensembl db: TGFBI Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for TGFBI
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: TGFBI Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GAAGGGAGACAATCGCTTTAGC
Reverse primer: TGTAGACTCCTTCCCGGTTGAG
Probe:
Amplicon:
Annealing temperature: 60
Application: TGFBI Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATCACCAACAACATCCAGCA
Reverse primer: CCGTTACCTTCAAGCATCGT
Probe:
Amplicon:
Annealing temperature: 60
Complete information for TGFBI gene (protein-coding), transforming growth factor, beta-induced, 68kDa
Transforming growth factor, beta-induced, 68kDa, also known as TGFBI (initially called BIGH3, BIG-H3), is a protein which in humans is encoded by the TGFBI gene.[1][2] ...
The official name of this gene is "transforming growth factor, beta-induced, ... TGFBI is the gene's official symbol. The TGFBI gene is also known by other names, listed ...
Pampukha VN. [TGFBI gene mutations in the Ukrainian patients with inherited corneal stromal dystrophies]. Genetika 44:1392 (2008)
TGFBI gene mutations in corneal dystrophies. Kannabiran C, Klintworth GK. ... Over 30 mutations causing LCD and GCD have been identified so far in the TGFBI. ...
Late-onset form of lattice corneal dystrophy caused by leu527Arg mutation of the TGFBI gene. Hirano K, Hotta Y, Nakamura M, Fujiki K, Kanai A, Yamamoto N. ...
Novel L558P Mutation of the TGFBI Gene Found in Ukrainian Families with Atypical Corneal Dystrophy ... Exons of the TGFBI gene were amplified by polymerase chain reaction ...
TGFBI gene mutations in Brazilian patients with corneal dystrophy. The authors do not have any commercial or proprietary interest in the products used in this study ...
the TGFBI gene which consisted of an adenine to. guanine change at ... Molecular studies of the TGFBI gene: after. obtaining the approval of the patients and of ...
Two Mutations in the TGFBI (BIGH3) Gene Associated with Lattice Corneal Dystrophy in an ... Two mutations in the TGFBI gene (A546D and P551Q) cosegregated with ...
To identify mutations in the TGFBI gene in Indian. patients with lattice corneal dystrophy ... 1. Details of TGFBI Gene Mutations and Phenotypes of Probands with ...
Unilateral lattice corneal dystrophy associated with the novel His572del mutation in the TGFBI gene ... The identification of the TGFBI gene and characterization of the ...
A novel mutation I522N within the TGFBI gene caused lattice corneal dystrophy I ... Purpose: To identify mutations within the TGFBI gene in a Chinese family with lattice ...
transforming growth factor beta-induced gene (TGFBI), for ... Right: nucleotide sequence of TGFBI gene exon 12 of proband's mother A-II-2 (antisense ...
Register and you can start organising your references online. TGFBI gene mutations in the Ukrainian patients with inherited corneal stromal dystrophies Export ...