transforming growth factor, beta-induced, 68kDa (TGFBI)

Name: TGFBI
Description: transforming growth factor, beta-induced, 68kDa
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 5
GeneticSource: genomic
MapLocation: 5q31
OtherAliases: BIGH3, CDB1, CDG2, CDGG1, CSD, CSD1, CSD2, CSD3, EBMD, LCD1
OtherDesignations: RGD-containing collagen-associated protein|kerato-epithelin
NomenclatureSymbol: TGFBI
NomenclatureName: transforming growth factor, beta-induced, 68kDa
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 44016
Summary: This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq]
ChrSort: 05
ChrStart: 135364583

UniProtein db: TGFBI UniProt protein knowledge database
Ensembl db: TGFBI Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for TGFBI
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: TGFBI Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GAAGGGAGACAATCGCTTTAGC
Reverse primer: TGTAGACTCCTTCCCGGTTGAG
Probe:
Amplicon:
Annealing temperature: 60

Application: TGFBI Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATCACCAACAACATCCAGCA
Reverse primer: CCGTTACCTTCAAGCATCGT
Probe:
Amplicon:
Annealing temperature: 60

TGFBI news
Related resources on TGFBI