transcription factor 12 (TCF12)
Name: TCF12
Description: transcription factor 12
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 15
GeneticSource: genomic
MapLocation: 15q21
OtherAliases: HEB, HTF4, HsT17266, bHLHb20
OtherDesignations: helix-loop-helix transcription factor 4
NomenclatureSymbol: TCF12
NomenclatureName: transcription factor 12
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 6815
Summary: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq]
ChrSort: 15
ChrStart: 57210832
UniProtein db: TCF12 UniProt protein knowledge database
Ensembl db: TCF12 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for TCF12
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: TCF12 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GGCGGCAGGACCTGCTA
Reverse primer: AGGTCGCTCAGCTCCTTGTC
Probe:
Amplicon:
Annealing temperature: 60
Complete information for TCF12 gene (protein-coding), transcription factor 12
Transcription factor 12 is a protein that in humans is encoded by the TCF12 gene.[1][2] ... Toward a catalog of human genes and proteins: sequencing and analysis ...
The world's first wiki where authorship really matters. Due credit and reputation for ... In addition, intron 5 in the TCF12 gene corresponds to the region involved in a ...
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
The human TCF12 gene, mapping to 15q21, encodes the helix-loop-helix transcription factor 4 (HTF4) ... The gene includes 21 exons and is significantly larger than an ...
Gene expression in the mouse brain for the gene Tcf12, also known as 'transcription factor 12'
Localization of the human HTF4 transcription factors 4 gene (TCF12) to chromosome 15q21. ... Identification and localization of genes that encode regulators of ...
TCF12 (transcription factor 12), Authors: Goran Stenman. Published in: Atlas Genet Cytogenet Oncol Haematol.
Rat Gene Tcf12. General Information. All the following links open in a new window: Aliases: ... The annotation for this gene is forthcoming over the next few months. ...
Mouse Tcf12 Chr9:71693560-71959426 bp, - strand has data for genome coordinates, ... Entrez Gene. 21406. International Mouse Knockout Project Status. Tcf12. Protein. domains ...
Buy quality rabbit TCF12 antibody (interacts with human), anti-TCF12, TCF12 antibody, rabbit polyclonal antibody, TCF12 Antibody, Rabbit Polyclonal Antibody (wb n/a) ...
Histogram - Click for a histogram of the full gene sequence and mutation details. ... Publications - Click for a complete list of curated publications for TCF12 ...
Ortholog genes: Cgn (Rat) , Cgnl1 (Rat) , LOC688265 (Rat) , TCF12 (Human) , Tcf12 (Mouse) , Tcf12 (Rat) ... siRNA type: Display siRNA(s) per gene rescue siRNAs only (more ...
TCF12 - BioPortfolio ... The human TCF12 gene, mapping to 15q21, encodes the helix-loop-helix transcription factor 4 (HTF4). A detailed analysis of this genomic region ...