transcription factor 12 (TCF12)

Name: TCF12
Description: transcription factor 12
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 15
GeneticSource: genomic
MapLocation: 15q21
OtherAliases: HEB, HTF4, HsT17266, bHLHb20
OtherDesignations: helix-loop-helix transcription factor 4
NomenclatureSymbol: TCF12
NomenclatureName: transcription factor 12
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 6815
Summary: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq]
ChrSort: 15
ChrStart: 57210832

UniProtein db: TCF12 UniProt protein knowledge database
Ensembl db: TCF12 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for TCF12
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: TCF12 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GGCGGCAGGACCTGCTA
Reverse primer: AGGTCGCTCAGCTCCTTGTC
Probe:
Amplicon:
Annealing temperature: 60

TCF12 news
Related resources on TCF12