solute carrier family 16, member 1 (monocarboxylic acid transporter 1) (SLC16A1)

Name: SLC16A1
Description: solute carrier family 16, member 1 (monocarboxylic acid transporter 1)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 1
GeneticSource: genomic
MapLocation: 1p12
OtherAliases: FLJ36745, HHF7, MCT, MCT1, MGC44475
OtherDesignations: monocarboxylate transporter 1|solute carrier family 16 (monocarboxylic acid transporters), member 1|solute carrier family 16, member 1
NomenclatureSymbol: SLC16A1
NomenclatureName: solute carrier family 16, member 1 (monocarboxylic acid transporter 1)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 14161
Summary: The protein encoded by this gene is a proton-linked monocarboxylate transporter that catalyzes the movement of many monocarboxylates, such as lactate and pyruvate, across the plasma membrane. Mutations in this gene are associated with erythrocyte lactate transporter defect. Alternatively spliced transcript variants have been found for this gene.
ChrSort: 01
ChrStart: 113454468

UniProtein db: SLC16A1 UniProt protein knowledge database
Ensembl db: SLC16A1 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for SLC16A1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: SLC16A1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CACTTAAAATGCCACCAGCA
Reverse primer: AGAGAAGCCGATGGAAATGA
Probe:
Amplicon:
Annealing temperature: 60

SLC16A1 news
Related resources on SLC16A1