secretogranin II (chromogranin C) (SCG2)

Name: SCG2
Description: secretogranin II (chromogranin C)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 2
GeneticSource: genomic
MapLocation: 2q35-q36
OtherAliases: CHGC, SN, SgII
OtherDesignations: Chromogranin C (secretogranin II)|EM66|secretogranin II|secretoneurin
NomenclatureSymbol: SCG2
NomenclatureName: secretogranin II (chromogranin C)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 8045
Summary: The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq]
ChrSort: 02
ChrStart: 224461657

UniProtein db: SCG2 UniProt protein knowledge database
Ensembl db: SCG2 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for SCG2
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: SCG2 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ACTTTCCAATGGACATGAGTGATG
Reverse primer: TAGGAGGGAATTGCATGTGCTT
Probe:
Amplicon:
Annealing temperature: 60

SCG2 news
Related resources on SCG2