5'-nucleotidase, cytosolic II (NT5C2)

Name: NT5C2
Description: 5 -nucleotidase, cytosolic II
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 10
GeneticSource: genomic
MapLocation: 10q24.32-q24.33
OtherAliases: RP11-30H12.3, GMP, NT5B, PNT5, cN-II
OtherDesignations: 5 -nucleotidase (purine), cytosolic type B|IMP-specific 5 -NT|purine 5 nucleotidase
NomenclatureSymbol: NT5C2
NomenclatureName: 5 -nucleotidase, cytosolic II
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 4282
Summary: Purine 5-prime-nucleotidase (EC 3.1.3.5) preferentially hydrolyzes inosine 5-prime-monophosphate (IMP) and other purine nucleotides, and is allosterically activated by various compounds, including ATP. The enzyme is exclusively located in the cytoplasmic matrix of cells and may have a critical role in the maintenance of a constant composition of intracellular purine/pyrimidine nucleotides in cooperation with other nucleotidases.[supplied by OMIM]
ChrSort: 10
ChrStart: 104845939

UniProtein db: NT5C2 UniProt protein knowledge database
Ensembl db: NT5C2 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for NT5C2
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: NT5C2 Gene Expression Quantification/Detection Taqman PCR
Forward primer: ACCTGCTGTATTACCCTTTCAGCTA
Reverse primer: GCTCCACCGTTGATTCATGA
Probe: CTCTTCAGGGCTGCCCATGTCTTGA
Amplicon:
Annealing temperature: 60

Application: NT5C2 Gene Expression Quantification/Detection Taqman PCR
Forward primer: GGCAAGCTGAAAATTGGTACCT
Reverse primer: TCGTATCAGAAGAACCTCCTGAGTAG
Probe: ACAGGGCCCCTACAGCATGGTATCG
Amplicon:
Annealing temperature: 60

Application: NT5C2 Gene Expression Quantification/Detection Taqman PCR
Forward primer: ACCTGCTGTATTACCCTTTCAGCTA
Reverse primer: GCTCCACCGTTGATTCATGA
Probe: CTCTTCAGGGCTGCCCATGTCTTGA
Amplicon:
Annealing temperature: 60

NT5C2 news
Related resources on NT5C2