natriuretic peptide precursor A (NPPA)

Name: NPPA
Description: natriuretic peptide precursor A
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 1
GeneticSource: genomic
MapLocation: 1p36.21
OtherAliases: ANF, ANP, ATFB6, CDD-ANF, PND
OtherDesignations: atrial natriuretic factor|atriopeptin|cardionatrin|prepronatriodilatin
NomenclatureSymbol: NPPA
NomenclatureName: natriuretic peptide precursor A
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 35626
Summary: The protein encoded by this gene belongs to the natriuretic peptide family. Natriuretic peptides are implicated in the control of extracellular fluid volume and electrolyte homeostasis. This protein is synthesized as a large precursor (containing a signal peptide), which is processed to release a peptide from the N-terminus with similarity to vasoactive peptide, cardiodilatin, and another peptide from the C-terminus with natriuretic-diuretic activity. Mutations in this gene have been associated with atrial fibrillation familial type 6. [provided by RefSeq]
ChrSort: 01
ChrStart: 11905775

UniProtein db: NPPA UniProt protein knowledge database
Ensembl db: NPPA Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for NPPA
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: NPPA Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCCATGTACAATGCCGTGT
Reverse primer: TCTTCCAAATGGTCCAGCA
Probe:
Amplicon:
Annealing temperature: 60

Application: NPPA Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GGATTTCAAGAATTTGCTGG
Reverse primer: GCAGATCGATCAGAGGAGTC
Probe:
Amplicon:
Annealing temperature: 60

Application: NPPA Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGTACAATGCCGTGTCCAAC
Reverse primer: TCTTCATTCGGCTCACTGAG
Probe:
Amplicon:
Annealing temperature: 60

NPPA news
Related resources on NPPA