nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (NFKBIA)
Name: NFKBIA
Description: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 14
GeneticSource: genomic
MapLocation: 14q13
OtherAliases: IKBA, MAD-3, NFKBI
OtherDesignations: IkappaBalpha|nuclear factor of kappa light chain gene enhancer in B-cells
NomenclatureSymbol: NFKBIA
NomenclatureName: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 51245
Summary: NFKB1 (MIM 164011) or NFKB2 (MIM 164012) is bound to REL (MIM 164910), RELA (MIM 164014), or RELB (MIM 604758) to form the NFKB complex. The NFKB complex is inhibited by I-kappa-B proteins (NFKBIA or NFKBIB, MIM 604495), which inactivate NF-kappa-B by trapping it in the cytoplasm. Phosphorylation of serine residues on the I-kappa-B proteins by kinases (IKBKA, MIM 600664, or IKBKB, MIM 603258) marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B complex. Activated NFKB complex translocates into the nucleus and binds DNA at kappa-B-binding motifs such as 5-prime GGGRNNYYCC 3-prime or 5-prime HGGARNYYCC 3-prime (where H is A, C, or T; R is an A or G purine; and Y is a C or T pyrimidine).[supplied by OMIM]
ChrSort: 14
ChrStart: 35870715
UniProtein db: NFKBIA UniProt protein knowledge database
Ensembl db: NFKBIA Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for NFKBIA
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: NFKBIA Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCGCACCTCCACTCCATCC
Reverse primer: ACATCAGCACCCAAGGACACC
Probe:
Amplicon:
Annealing temperature: 60
Application: NFKBIA Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCTCTGGCAGCATCTGAAGGT
Reverse primer: CCCAAGCACCCGGATACAG
Probe: TTCTAGTGTCAGCTGGCCCAGCTGC
Amplicon:
Annealing temperature: 60
Complete information for NFKBIA gene (protein-coding), nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
These steroid hormone receptors are important regulators of gene expression and differentiation. ... The gene expression of NFKbia in the WY14, 643 control and transgenic ...
This study investigated common variants within the genes coding for NF-kappaB and IkappaB, NFKB1 and NFKBIA, for involvement in sporadic breast cancer [2] ...
NFKBIA was found to be a susceptibility gene for German ... The NFKBIA gene is located on chromosome 14q13, which is close to the IBD4 region found in genome wide ...
HLA, NFKB1 and NFKBIA gene polymorphism profile in autoimmune diabetes mellitus patients. ... In our study the gene polymorphism of HLA class II, NFKB1 (nuclear ...
Human protein-coding gene NFKBIA. Represented by 751 ESTs from 278 cDNA libraries. ... Tissues and development stages from this gene's sequences survey gene expression. ...
Polymorphism in the promoter region of the NFKBIA gene is rare in Swedish and Chinese colorectal cancer ... in the promoter region of the NFKBIA gene is related to colorectal ...
Mouse Nfkbia Chr12:56590831-56593570 bp, - strand has data for genome ... Mice homozygous for disruptions in this gene die at about 1 week of age experiencing ...
NFKBIA inhibits NF-kappa-B by forming a complex with it, and may be involved in ... NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells ...
The Nfkbia gene was disrupted using an in frame insertion vector ... Nfkbia, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, ...
the NFKBIA, NFKBIE and TNFAIP3 genes.5–7 The latter genes hence ... For the NFKBIA gene, a single replacement mutation was found in exon 5 of one ...
Human gene symbol report page for 'NFKBIA - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha'
common I B gene polymorphisms confer susceptibility to common ... genes in the vicinity of NFKBIA and NFKBIE (Figures 1 and. 3) further suggests that the ...
Edit this page in Wiki Genes - NFKBIA or see Wiki Gene. TBK-1 and IKK-i phosphorylate Ser ... A polymorphism of the NFKBIA gene is associated with Crohn's disease ...
Rare NFKBIA mutations cause immunodeficiency with severe bacterial infection, ... described with mutations in the NFKBIA gene leading to impaired NF-B activation ...