nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (NFKBIA)

Name: NFKBIA
Description: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 14
GeneticSource: genomic
MapLocation: 14q13
OtherAliases: IKBA, MAD-3, NFKBI
OtherDesignations: IkappaBalpha|nuclear factor of kappa light chain gene enhancer in B-cells
NomenclatureSymbol: NFKBIA
NomenclatureName: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 51245
Summary: NFKB1 (MIM 164011) or NFKB2 (MIM 164012) is bound to REL (MIM 164910), RELA (MIM 164014), or RELB (MIM 604758) to form the NFKB complex. The NFKB complex is inhibited by I-kappa-B proteins (NFKBIA or NFKBIB, MIM 604495), which inactivate NF-kappa-B by trapping it in the cytoplasm. Phosphorylation of serine residues on the I-kappa-B proteins by kinases (IKBKA, MIM 600664, or IKBKB, MIM 603258) marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B complex. Activated NFKB complex translocates into the nucleus and binds DNA at kappa-B-binding motifs such as 5-prime GGGRNNYYCC 3-prime or 5-prime HGGARNYYCC 3-prime (where H is A, C, or T; R is an A or G purine; and Y is a C or T pyrimidine).[supplied by OMIM]
ChrSort: 14
ChrStart: 35870715

UniProtein db: NFKBIA UniProt protein knowledge database
Ensembl db: NFKBIA Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for NFKBIA
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: NFKBIA Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCGCACCTCCACTCCATCC
Reverse primer: ACATCAGCACCCAAGGACACC
Probe:
Amplicon:
Annealing temperature: 60

Application: NFKBIA Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCTCTGGCAGCATCTGAAGGT
Reverse primer: CCCAAGCACCCGGATACAG
Probe: TTCTAGTGTCAGCTGGCCCAGCTGC
Amplicon:
Annealing temperature: 60

NFKBIA news
Related resources on NFKBIA