neurogenic differentiation 1 (NEUROD1)
Name: NEUROD1
Description: neurogenic differentiation 1
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 2
GeneticSource: genomic
MapLocation: 2q32
OtherAliases: BETA2, BHF-1, NEUROD, bHLHa3
OtherDesignations: basic helix-loop-helix transcription factor|beta-cell E-box transactivator 2|neurogenic differentiation factor 1|neurogenic helix-loop-helix protein NEUROD
NomenclatureSymbol: NEUROD1
NomenclatureName: neurogenic differentiation 1
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 17872
Summary: This gene encodes a member of the NeuroD family of basic helix-loop-helix (bHLH) transcription factors. The protein forms heterodimers with other bHLH proteins and activates transcription of genes that contain a specific DNA sequence known as the E-box. It regulates expression of the insulin gene, and mutations in this gene result in type II diabetes mellitus. [provided by RefSeq]
ChrSort: 02
ChrStart: 182541193
UniProtein db: NEUROD1 UniProt protein knowledge database
Ensembl db: NEUROD1 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for NEUROD1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: NEUROD1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TCACATCATGAGCGAGTCATGA
Reverse primer: TGAAACTGGCGTGCCTCTAA
Probe:
Amplicon:
Annealing temperature: 60
Complete information for NEUROD1 gene (protein-coding), neurogenic differentiation 1
Neurogenic differentiation 1 (NeuroD1), also called β2[1] is a transcription factor of the NeuroD-type. It is encoded by the human gene NEUROD1. ...
The world's first wiki where authorship really matters. Due credit and reputation for ... The NeuroD1/BETA2 sequences essential for insulin gene transcription colocalize ...
NeuroD1 gene and interleukin-18 gene polymorphisms in type 1 diabetes in Dalmatian ... NeuroD1 genotypes (GG, GA, AA) were identified by means of polymerase chain ...
We screened for the polymorphisms in NeuroD1 and Pax4 genes in 296 late-onset diabetic patients and 177 unrelated control subjects over 60 years of age. ...
NeuroD1 peptide. NeuroD1 (Neurogenic Differentiation factor 1, also known as BETA2, beta-cell E-box transactivator 2) is a 40kDa protein, a member of the bHLH family.
Certain MODY gene sequence variants may be involved in polygenic ... No HNF-4alpha, IPF-1, NEUROD1 or HNF-1beta gene mutations were identified in any of the ...
NeuroD1 gene were also overexpressed (Figure 4). Figure 4. RT-PCR analysis of the expression of the ... A gel-shift assay indicated that NeuroD1 was absent from. the DMS-79 ...
Neurogenic differentiation 1 (NeuroD1), also called β2 is a transcription factor of the NeuroD-type. It is encoded by the human gene NEUROD1. ...
Because we found that NeuroD1 potently represses. somatostatin expression in vitro, its ... genes regulated by NeuroD1 in the -cell. Moreover, the ability of Neu ...
Gene expression in the mouse brain for the gene Neurod1, also known as 'neurogenic differentiation 1'
Gene/insert name: N14 3'UTR. Alternative names: NeuroD. Insert size (bp) ... Gene/insert aliases: NEUROD1, BETA2, BHF-1, NEUROD, bHLHa3. Species of ...
Gene/insert name: N14 3'UTR mut. Alternative names: NeuroD. Insert size ... Gene/insert aliases: NEUROD1, BETA2, BHF-1, NEUROD, bHLHa3. Species of ...
NeuroD1 is widely expressed during development in the mammalian brain and pancreas where ... Changes in NeuroD1 gene expression have been linked to diabetes ...
Gene: NEUROD1. neurogenic differentiation 1. Overview. Related Genes ... curated publications that mention this gene along with other genes is available. ...