neurogenic differentiation 1 (NEUROD1)

Name: NEUROD1
Description: neurogenic differentiation 1
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 2
GeneticSource: genomic
MapLocation: 2q32
OtherAliases: BETA2, BHF-1, NEUROD, bHLHa3
OtherDesignations: basic helix-loop-helix transcription factor|beta-cell E-box transactivator 2|neurogenic differentiation factor 1|neurogenic helix-loop-helix protein NEUROD
NomenclatureSymbol: NEUROD1
NomenclatureName: neurogenic differentiation 1
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 17872
Summary: This gene encodes a member of the NeuroD family of basic helix-loop-helix (bHLH) transcription factors. The protein forms heterodimers with other bHLH proteins and activates transcription of genes that contain a specific DNA sequence known as the E-box. It regulates expression of the insulin gene, and mutations in this gene result in type II diabetes mellitus. [provided by RefSeq]
ChrSort: 02
ChrStart: 182541193

UniProtein db: NEUROD1 UniProt protein knowledge database
Ensembl db: NEUROD1 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for NEUROD1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: NEUROD1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TCACATCATGAGCGAGTCATGA
Reverse primer: TGAAACTGGCGTGCCTCTAA
Probe:
Amplicon:
Annealing temperature: 60

NEUROD1 news
Related resources on NEUROD1