myosin XVIIIB (MYO18B)

Name: MYO18B
Description: myosin XVIIIB
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 22
GeneticSource: genomic
MapLocation: 22q11.2-q12.1
OtherAliases: CTA-109D1.1, DKFZp434C2422, DKFZp779C1668, FLJ41942
OtherDesignations: myosin 18B
NomenclatureSymbol: MYO18B
NomenclatureName: myosin XVIIIB
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 3553
Summary: The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq]
ChrSort: 22
ChrStart: 26138119

UniProtein db: MYO18B UniProt protein knowledge database
Ensembl db: MYO18B Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for MYO18B
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: MYO18B Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CAGTGACCCATTCAGCTGGAA
Reverse primer: AGCTGGGAGGAAGTCATCGA
Probe:
Amplicon:
Annealing temperature: 60

MYO18B news
Related resources on MYO18B