met proto-oncogene (hepatocyte growth factor receptor) (MET)

Name: MET
Description: met proto-oncogene (hepatocyte growth factor receptor)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 7
GeneticSource: genomic
MapLocation: 7q31
OtherAliases: AUTS9, HGFR, RCCP2, c-Met
OtherDesignations: HGF receptor|SF receptor|met proto-oncogene|met proto-oncogene tyrosine kinase|oncogene MET|scatter factor receptor
NomenclatureSymbol: MET
NomenclatureName: met proto-oncogene (hepatocyte growth factor receptor)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 77546
Summary: The proto-oncogene MET product is the hepatocyte growth factor receptor and encodes tyrosine-kinase activity. The primary single chain precursor protein is post-translationally cleaved to produce the alpha and beta subunits, which are disulfide linked to form the mature receptor. Various mutations in the MET gene are associated with papillary renal carcinoma. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]
ChrSort: 07
ChrStart: 116312458

UniProtein db: MET UniProt protein knowledge database
Ensembl db: MET Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for MET
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: MET Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCGCTTCATGCAGGTTGTGG
Reverse primer: ATGGCTTGGGCTGCAGACA
Probe: CTCGATCAGGACCATCAACCCCTCAT
Amplicon:
Annealing temperature: 65

Application: MET Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TTCTGACCGAGGGAATCATCA
Reverse primer: CCTTCACTTCGCAGGCAGAT
Probe:
Amplicon:
Annealing temperature: 60

MET news
Related resources on MET