met proto-oncogene (hepatocyte growth factor receptor) (MET)

Name: MET
Description: met proto-oncogene (hepatocyte growth factor receptor)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 7
GeneticSource: genomic
MapLocation: 7q31
OtherAliases: AUTS9, HGFR, RCCP2, c-Met
OtherDesignations: HGF receptor|SF receptor|met proto-oncogene|met proto-oncogene tyrosine kinase|oncogene MET|scatter factor receptor
NomenclatureSymbol: MET
NomenclatureName: met proto-oncogene (hepatocyte growth factor receptor)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 77546
Summary: The proto-oncogene MET product is the hepatocyte growth factor receptor and encodes tyrosine-kinase activity. The primary single chain precursor protein is post-translationally cleaved to produce the alpha and beta subunits, which are disulfide linked to form the mature receptor. Various mutations in the MET gene are associated with papillary renal carcinoma. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]
ChrSort: 07
ChrStart: 116312458

UniProtein db: MET UniProt protein knowledge database
Ensembl db: MET Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for MET
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: MET Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCGCTTCATGCAGGTTGTGG
Reverse primer: ATGGCTTGGGCTGCAGACA
Probe: CTCGATCAGGACCATCAACCCCTCAT
Amplicon:
Annealing temperature: 65

Application: MET Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TTCTGACCGAGGGAATCATCA
Reverse primer: CCTTCACTTCGCAGGCAGAT
Probe:
Amplicon:
Annealing temperature: 60

MET news
  • Gene genie who devotes his life to helping kids
    • TRAINING in paediatrics in the early to mid-1980s, Professor John Christodoulou met children with disorders which interfered with the chemistry of the body.>> more ...
    Mon, 25 Jan 2010 18:07:52 -0500

  • Michael Howard Sacked as Tory Leader After Denying He is a Vampire
    • The Conservative Party leader has been forced to step down after it emerged he had denied allegations he is a vampire. However, after extensive analysis of his DNA, Tory officials discovered that Mr Howard has all the necessary genes to be genetically classified as a vampire.>> more ...
    Mon, 25 Jan 2010 11:55:24 -0500

  • Wrong to label H1N1 alert as fake: WHO
    • The World Health Organization has termed allegations of creating a fake pandemic around H1N1 swine flu virus to bring economic benefit to the pharma industry as "scientifically wrong and historically incorrect".>> more ...
    Tue, 26 Jan 2010 16:34:21 -0500

  • Mammoth Achievement: Researchers at the forefront of molecular biology
    • Forget Jurassic Park. By successfully sequencing the DNA of a long-extinct species, Stephan Schuster and Webb Miller have helped push back the boundaries of molecular biology.>> more ...
    Tue, 26 Jan 2010 15:23:08 -0500

  • Homosexuality: Evolutionary dead end?
    • Agony Aunt Carole Jahme shines the cold light of evolutionary psychology on readers' problems. This week: gay dads and punishment strategies I will survive From Joe, age 38 Dear Carole, I am a 38-year-old single gay man who is perfectly at ease with his sexuality, but I have this nagging feeling that I should be making an effort to perpetuate my genes. If I die without leaving any offspring ...>> more ...
    Sun, 24 Jan 2010 20:03:34 -0500

Related resources on MET
Meet Gene Goodman
Meet Gene Goodman. Gene Goodman is a Republican candidate for Congress ... As the owner of Versatube Corporation, Mr. Goodman is a Michigan manufacturer in ...

Real Estate for sale in Auburn, Meadow Vista, Meadow Vista ...
We provide the information needed to buy today or to meet your future real estate needs. Our professional... Thanks for taking the time to "Meet Gene Cain" ...

Meet Gene Marks - "Quicker! Better! Wiser!"
"Gene guided us through the jungle of the Internet and revealed some real jewels ... "Gene Marks' workshop, "Penny Pinching Sales And Marketing Ideas" was ...

c-Met - Wikipedia, the free encyclopedia
MET is a membrane receptor that is essential for embryonic development and wound healing. ... "Entrez Gene: MET met proto-oncogene (hepatocyte growth factor receptor) ...

Meet Gene Hargis, Professional Fishing Guide ...
If Gene Hargis tells you he doesn't miss coaching, it's a flat out lie. ... You give Gene a gridiron and a group of kids who are willing to play their ...

Real Estate Agents, Gene and Sharon West
Real estate agents, Gene and Sharon West can help you make decisions on buying a home ... Gene and Sharon are both native Floridians, born in Tampa. They met when they were ...

Autism Speaks, Science, Latest Research
The group of scientists examined a gene called MET tyrosine kinase and found a strong ... Moreover, the MET gene is located on chromosome 7 in a genetic region ...

MET Gene Variant Links Autism and GI Disorders, Autism
MET is a pleiotropic receptor that functions in both brain development and ... In the brain, the MET gene is expressed in developing circuits that are involved in ...

Modern Pathology - Missense Mutation of the MET Gene Detected ...
Missense Mutation of the MET Gene Detected in Human Glioma ... Three of 11 sporadic gliomas showed duplication of one copy of the MET gene, but none of them contained mutations. ...

Harrisonburg Candidate for Virginia House of Delegates
Information on Gene Hart, his background and his views on the political issues that impact the Shenandoah Valley. ...

Association of <i>MET</i> gene variants with autism ...
Association of MET gene variants with autism susceptibility. ... Overall, these results provide further evidence that the MET gene plays a role in autism susceptibility. ...

Search Tucson Homes and Real Estate - Meet Gene - Gene Thiel
Gene Thiel's Biography ... Meet Gene. The more you know about buying or selling a home, the more confident you'll feel about the decisions you make. ...

Meet Gene - TEDChris: The untweetable
Meet Gene. I met a remarkable man just now on the street near our home in Tribeca, New York. ... Gene walked at twice my speed, ignoring the traffic, still going ...

Meet Gene Rurka
Meet Gene Rurka - Safari Club International Humanitarian Foundation Chairman ... Exotic-foods expert Gene Rurka (left) puts the finishing touches on the caribou ...

NCI Cancer Bulletin for May 15, 2007 (HTML) - National Cancer ...
The MET gene was discovered at NCI in 1984 in the laboratory of Dr. George Vande Woude. ... The MET gene, however, is not controlled by EGFR, nor does it normally interact with ...