mitogen-activated protein kinase kinase kinase 11 (MAP3K11)
Name: MAP3K11
Description: mitogen-activated protein kinase kinase kinase 11
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 11
GeneticSource: genomic
MapLocation: 11q13.1-q13.3
OtherAliases: MEKK11, MGC17114, MLK-3, MLK3, PTK1, SPRK
OtherDesignations: SH3 domain-containing proline-rich kinase|mixed lineage kinase 3|protein-tyrosine kinase PTK1
NomenclatureSymbol: MAP3K11
NomenclatureName: mitogen-activated protein kinase kinase kinase 11
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 10410
Summary: The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq]
ChrSort: 11
ChrStart: 65365225
UniProtein db: MAP3K11 UniProt protein knowledge database
Ensembl db: MAP3K11 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for MAP3K11
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: MAP3K11 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCCCATTGAGAGTGACGACAT
Reverse primer: CGGCACTCATTTGTGTGGTT
Probe:
Amplicon:
Annealing temperature: 60
Complete information for MAP3K11 gene (protein-coding), mitogen-activated protein kinase kinase kinase 11
The protein encoded by this gene is a member of the serine/threonine kinase ... "Entrez Gene: MAP3K11 mitogen-activated protein kinase kinase kinase 11" ...
The sequence and genomic organisation of the Kcnk6 and Map3k11 genes are described in detail. ... This gene cluster maps to the vicinity of the Dancer (Dc) mutation, which ...
Mouse Map3k11 Chr19:5689770-5702862 bp, + strand has data for genome coordinates, mammalian orthology, sequences, phenotypes, polymorphisms, SNPs, ...
The sequence and genomic organisation of the Kcnk6 and Map3k11 genes are described in detail. ... This gene cluster maps to the vicinity of the Dancer (Dc) mutation, which ...
The invention more specifically discloses that the MAP3K11 gene on chromosome 11 and certain alleles thereof are related to susceptibility to obesity ...
SNP linked to Gene MAP3K11(geneID:4296) Via Contig Annotation ... Total gene model (contig mRNA transcript): 1. mrna. transcript. protein. mrna orientation ...
Browse > By Gene > MAP3K11. MAP3K11: mitogen-activated protein kinase kinase kinase 11 ... Addgene does not currently have plasmids containing this gene. ...
The data in COSMIC for MAP3K11 is from selected papers only and does not represent a wide survey of publications for this gene. Small Intragenic Mutation Summary ...
Gene Name. MAP3K11 (HGNC Symbol) Synonyms: MGC17114, PTK1, MLK-3, MLK3, ... Histogram - Click for a histogram of the full gene sequence and mutation details. ...
The sequence and genomic organisation of the Kcnk6 and Map3k11 genes are described in detail. ... This gene cluster maps to the vicinity of the Dancer (Dc) mutation, which ...
The world's first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. ...
Gene Symbol. Species. Entrez Gene ID. mitogen-activated protein kinase kinase kinase 11 ... Gene Details MAP3K11 : mitogen-activated protein kinase kinase kinase ...
MAP3K11 (mitogen-activated protein kinase kinase kinase 11) Identity ... who wish to write a full paper/card on this gene, go to How to contribute ...