mitogen-activated protein kinase kinase kinase 11 (MAP3K11)

Name: MAP3K11
Description: mitogen-activated protein kinase kinase kinase 11
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 11
GeneticSource: genomic
MapLocation: 11q13.1-q13.3
OtherAliases: MEKK11, MGC17114, MLK-3, MLK3, PTK1, SPRK
OtherDesignations: SH3 domain-containing proline-rich kinase|mixed lineage kinase 3|protein-tyrosine kinase PTK1
NomenclatureSymbol: MAP3K11
NomenclatureName: mitogen-activated protein kinase kinase kinase 11
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 10410
Summary: The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq]
ChrSort: 11
ChrStart: 65365225

UniProtein db: MAP3K11 UniProt protein knowledge database
Ensembl db: MAP3K11 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for MAP3K11
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: MAP3K11 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCCCATTGAGAGTGACGACAT
Reverse primer: CGGCACTCATTTGTGTGGTT
Probe:
Amplicon:
Annealing temperature: 60

MAP3K11 news
Related resources on MAP3K11