killer cell lectin-like receptor subfamily K, member 1 (KLRK1)

Name: KLRK1
Description: killer cell lectin-like receptor subfamily K, member 1
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 12
GeneticSource: genomic
MapLocation: 12p13.2-p12.3
OtherAliases: CD314, D12S2489E, FLJ17759, FLJ75772, KLR, NKG2-D, NKG2D
OtherDesignations: NK cell receptor D|NKG2-D type II integral membrane protein
NomenclatureSymbol: KLRK1
NomenclatureName: killer cell lectin-like receptor subfamily K, member 1
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 35462
Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. This gene encodes a member of the NKG2 family, and the encoded transmembrane protein is characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed in NK cells. [provided by RefSeq]
ChrSort: 12
ChrStart: 10524951

UniProtein db: KLRK1 UniProt protein knowledge database
Ensembl db: KLRK1 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for KLRK1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: KLRK1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GGCTTTTATCCACAAGAATCAAGATC
Reverse primer: GTGCACGTCTACCGCAGAGA
Probe:
Amplicon:
Annealing temperature: 60

Application: KLRK1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGCATGCAAAGGACTGTGTAAAG
Reverse primer: GCAGTGTTACCGCTGGTGTAATC
Probe:
Amplicon:
Annealing temperature: 59

KLRK1 news
Related resources on KLRK1