killer cell lectin-like receptor subfamily K, member 1 (KLRK1)
Name: KLRK1
Description: killer cell lectin-like receptor subfamily K, member 1
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 12
GeneticSource: genomic
MapLocation: 12p13.2-p12.3
OtherAliases: CD314, D12S2489E, FLJ17759, FLJ75772, KLR, NKG2-D, NKG2D
OtherDesignations: NK cell receptor D|NKG2-D type II integral membrane protein
NomenclatureSymbol: KLRK1
NomenclatureName: killer cell lectin-like receptor subfamily K, member 1
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 35462
Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. This gene encodes a member of the NKG2 family, and the encoded transmembrane protein is characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed in NK cells. [provided by RefSeq]
ChrSort: 12
ChrStart: 10524951
UniProtein db: KLRK1 UniProt protein knowledge database
Ensembl db: KLRK1 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for KLRK1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: KLRK1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GGCTTTTATCCACAAGAATCAAGATC
Reverse primer: GTGCACGTCTACCGCAGAGA
Probe:
Amplicon:
Annealing temperature: 60
Application: KLRK1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGCATGCAAAGGACTGTGTAAAG
Reverse primer: GCAGTGTTACCGCTGGTGTAATC
Probe:
Amplicon:
Annealing temperature: 59
Complete information for KLRK1 gene (protein-coding), killer cell lectin-like receptor subfamily K, member 1
The NKG2 gene family is located within the NK complex, a region that contains several ... "Entrez Gene: KLRK1 killer cell lectin-like receptor subfamily K, ...
KLRK1 is present on chromosome 12 within a cluster of genes referred to as the "NK ... The KLRK1 gene is 37,793 bases located on the negative strand of chromosome 12 ...
KLRK1 is flanked by KLRD1 (CD94) on the centromeric and KLRC4 (NKG2F) on the telomeric side. ... KLRK1 is present on chromosome 12 within a cluster of genes referred ...
Mouse Klrk1 Chr6:129560341-129573882 bp, - strand has data for genome ... Klrk1 Gene Detail. Symbol. Name. ID. Klrk1. killer cell lectin-like receptor subfamily K, ...
rs2273535, a SNP in the AURKA gene. rs7903146, a SNP originally associated with risk for type-2 diabetes ... rs1049174, a SNP representing a haplotype of the KLRK1 gene ...
SNP linked to Gene KLRK1(geneID:22914) Via Contig Annotation ... Total gene model (contig mRNA transcript): 1. mrna. transcript. protein. mrna orientation ...
SNP Nexus. Gene. KLRK1. Chromosome. 12. Orientation. minus. Position. 10416632. Genotype. Effect ... associated with haplotypes of the KLRK1 gene defined by SNP rs1049174. ...
Human gene symbol report page for 'KLRK1 - killer cell lectin-like receptor subfamily K, member 1'
Transcript: Klrk1-002. Transcript-based displays. Transcript summary ... is a product of gene ENSMUSG00000030149 - There are 2 transcripts in this gene: ...
A study of natural killer cell lectin-like receptor K1 gene (KLRK1/NKG2D) region polymorphisms in a European population sample. Ucisik-Akkaya E, Dorak MT. ...
By gene targeting, we replaced six exons of the Klrk1 gene with ... By using Klrk1 gene-targeted mice, we have provided direct ge- netic evidence for a role ...
KLRK1 - Wikipedia, the free encyclopedia. NKG2-D type II integral membrane protein is a protein that in humans is encoded by the KLRK1 gene. ...
Gene: KLRK1. killer cell lectin-like receptor subfamily K, member 1 ... PharmGKB sets gene boundaries by expanding the mRNA boundaries by no less than ...
KLRK1 killer cell lectin-like receptor subfamily K, member 1. Also known as: Klrk1, CD314, ... Gene function, process, cellular location or interacting partner (as ...