potassium voltage-gated channel, Shaw-related subfamily, member 3 (KCNC3)
Name: KCNC3
Description: potassium voltage-gated channel, Shaw-related subfamily, member 3
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 19
GeneticSource: genomic
MapLocation: 19q13.3-q13.4
OtherAliases: KSHIIID, KV3.3, SCA13
OtherDesignations: Shaw-related voltage-gated potassium channel protein 3|voltage-gated potassium channel protein KV3.3
NomenclatureSymbol: KCNC3
NomenclatureName: potassium voltage-gated channel, Shaw-related subfamily, member 3
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 3858
Summary: The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. [provided by RefSeq]
ChrSort: 19
ChrStart: 50818764
UniProtein db: KCNC3 UniProt protein knowledge database
Ensembl db: KCNC3 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for KCNC3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: KCNC3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCTCTTCGAGGACCCCTACTC
Reverse primer: AAGCCCTCATGGGTTTCCA
Probe:
Amplicon:
Annealing temperature: 60
Complete information for KCNC3 gene (protein-coding), potassium voltage-gated channel, Shaw-related subfamily, member 3
Using probes derived from a human genomic clone containing the 3' exon of human Kv3.3 (KCNC3), we have localized the gene to human chromosome 19 [2] ...
OMIM: 176264 MGI: 96669 HomoloGene: 3650 IUPHAR: Kv3.3 GeneCards: KCNC3 Gene ... The Shaker gene family of Drosophila encodes components of voltage-gated potassium ...
Mouse Kcnc3 Chr7:51846034-51860124 bp, + strand has data for genome coordinates, ... Kcnc3 Gene Detail. Symbol. Name. ID. Kcnc3. potassium voltage gated channel, Shaw-related ...
"This type of gene has never before been linked to nerve cell death," says Stefan ... The KCNC3 gene codes for a type of potassium channel that normally opens and ...
According to Dr Stefan Pulst "This type of gene has never before been linked to nerve cell death. ... The KCNC3 gene codes for one of the proteins that form potassium channels. ...
in exon 2 of the KCNC3 gene (silent mutation GGC (Gly) to GGT (Gly) ... The gene KCNC3 codes for a protein called KCNC3 which is a potassium channel. ...
The implicated gene, KCNC3, and two mutations are described in the journal ... KCNC3 forms a potassium channel, part of a biochemical mechanism that regulates ...
The implicated gene, KCNC3, and two mutations are described in the journal ... KCNC3 forms a potassium channel, part of a biochemical mechanism that regulates ...
KCNC3 gene. Protein phosphatase 2A gene. Voltage dependent calcium channel gene. The ... 2 gene using a direct identification of repeat expansion and cloning ...
The mutated KCNC3 genes are linked to nerve death in these disorders. ... "This type of gene has never before been linked to nerve cell death," says Stefan ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
Unlike the vertebrate Shaker-related genes that have intronless coding regions, ... of the KCNC3 gene, resulting in an arg420-to-his (R420H) substitution ...
The implicated gene, KCNC3, and two mutations are described in the ... aggregation, but the identification of KCNC3 mutations and their functional characterization represent a ...
Rat Gene Kcnc3. General Information. All the following links open in a new window: Aliases: ... The annotation for this gene is forthcoming over the next few months. ...