potassium voltage-gated channel, Shaw-related subfamily, member 3 (KCNC3)

Name: KCNC3
Description: potassium voltage-gated channel, Shaw-related subfamily, member 3
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 19
GeneticSource: genomic
MapLocation: 19q13.3-q13.4
OtherAliases: KSHIIID, KV3.3, SCA13
OtherDesignations: Shaw-related voltage-gated potassium channel protein 3|voltage-gated potassium channel protein KV3.3
NomenclatureSymbol: KCNC3
NomenclatureName: potassium voltage-gated channel, Shaw-related subfamily, member 3
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 3858
Summary: The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. [provided by RefSeq]
ChrSort: 19
ChrStart: 50818764

UniProtein db: KCNC3 UniProt protein knowledge database
Ensembl db: KCNC3 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for KCNC3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: KCNC3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCTCTTCGAGGACCCCTACTC
Reverse primer: AAGCCCTCATGGGTTTCCA
Probe:
Amplicon:
Annealing temperature: 60

KCNC3 news
Related resources on KCNC3