K(lysine) acetyltransferase 2A (KAT2A)

Name: KAT2A
Description: K(lysine) acetyltransferase 2A
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21
OtherAliases: GCN5, GCN5L2, MGC102791, PCAF-b, hGCN5
OtherDesignations: GCN5 (general control of amino-acid synthesis, yeast, homolog)-like 2|General control of amino acid synthesis, yeast, homolog-like 2|general control of amino acid synthesis 5-like 2
NomenclatureSymbol: KAT2A
NomenclatureName: K(lysine) acetyltransferase 2A
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 9250
Summary: KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM]
ChrSort: 17
ChrStart: 40265128

UniProtein db: KAT2A UniProt protein knowledge database
Ensembl db: KAT2A Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for KAT2A
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: KAT2A Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTTCAGTCAGTGCAGCGGTTG
Reverse primer: TCCTCTTCTCGCCTGGCATAG
Probe:
Amplicon:
Annealing temperature: 60

KAT2A news
Related resources on KAT2A