K(lysine) acetyltransferase 2A (KAT2A)
Name: KAT2A
Description: K(lysine) acetyltransferase 2A
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21
OtherAliases: GCN5, GCN5L2, MGC102791, PCAF-b, hGCN5
OtherDesignations: GCN5 (general control of amino-acid synthesis, yeast, homolog)-like 2|General control of amino acid synthesis, yeast, homolog-like 2|general control of amino acid synthesis 5-like 2
NomenclatureSymbol: KAT2A
NomenclatureName: K(lysine) acetyltransferase 2A
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 9250
Summary: KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM]
ChrSort: 17
ChrStart: 40265128
UniProtein db: KAT2A UniProt protein knowledge database
Ensembl db: KAT2A Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for KAT2A
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: KAT2A Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTTCAGTCAGTGCAGCGGTTG
Reverse primer: TCCTCTTCTCGCCTGGCATAG
Probe:
Amplicon:
Annealing temperature: 60
Complete information for KAT2A gene (protein-coding), K(lysine) acetyltransferase 2A
Quantity: 100 µg. Description: Gene: K(Lysine) Acetyltransferase 2A (KAT2A) Gene Symbol: KAT2A Synonyms: KAT2A, gcn5 Immunogen: Synthetic peptide (C-FYFKLKEGG ...
KAT2A-002. ENST00000465682. No protein product. processed_transcript. Transcript and Gene ... Gene views which provide displays for data associated at the gene ...
Histone acetyltransferase KAT2A is an enzyme that in humans is encoded by the KAT2A gene.[1][2] [edit] ... The human transcriptional adaptor genes TADA2L and GCN5L2 colocalize ...
The world's first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Browse > By Gene > KAT2A. KAT2A: K(lysine) acetyltransferase 2A ... an email alert whenever other plasmids containing this gene become available, click here. ...
SNP linked to Gene KAT2A(geneID:2648) Via Contig Annotation ... Total gene model (contig mRNA transcript): 1. mrna. transcript. protein. mrna orientation ...
GeneGlobe Search Center. For gene-specific products: human, mouse, rat, and other species ... Gene Details Kat2a : K(lysine) acetyltransferase 2A - Mouse ...
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
Gene/insert aliases: KAT2A, GCN5, hGCN5, GCN5L2, PCAF-b, MGC102791. Species of gene(s): H. sapiens (human) Fusion proteins or tags: flag. Terminal: ...
Gene Symbol. Species. Entrez Gene ID. K(lysine) acetyltransferase 2A. KAT2A. Human. 2648 ... Gene Details KAT2A : K(lysine) acetyltransferase 2A - Human ...
KAT2A (K(lysine) acetyltransferase 2A), Authors: Dessen P, Le Minor S. Published in: Atlas Genet Cytogenet Oncol Haematol.
KAT2A / GCN5 Partial Recombinant Protein : Western blot, ELISA. Species: Hu. G
Histone acetyltransferase KAT2A is an enzyme that in humans is encoded by the KAT2A gene. ... Granada: last Moorish stronghold in Spain, led by Muhammad XI, surrendered to Roman ...
STAF97. Gene names. Name: KAT2A. Synonyms: GCN5, GCN5L2, HGCN5. Organism ... activity and may help inducing chromatin remodeling of proviral genes. ...