integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3)

Name: ITGB3
Description: integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21.32
OtherAliases: CD61, GP3A, GPIIIa
OtherDesignations: integrin beta chain, beta 3|platelet glycoprotein IIIa
NomenclatureSymbol: ITGB3
NomenclatureName: integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 151239
Summary: The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq]
ChrSort: 17
ChrStart: 45331207

UniProtein db: ITGB3 UniProt protein knowledge database
Ensembl db: ITGB3 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ITGB3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ITGB3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GTGACCTGAAGGAGAATCTGC
Reverse primer: TTCTTCGAATCATCTGGCC
Probe:
Amplicon:
Annealing temperature: 60

ITGB3 news
Related resources on ITGB3