integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3)
Name: ITGB3
Description: integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21.32
OtherAliases: CD61, GP3A, GPIIIa
OtherDesignations: integrin beta chain, beta 3|platelet glycoprotein IIIa
NomenclatureSymbol: ITGB3
NomenclatureName: integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 151239
Summary: The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq]
ChrSort: 17
ChrStart: 45331207
UniProtein db: ITGB3 UniProt protein knowledge database
Ensembl db: ITGB3 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for ITGB3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: ITGB3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GTGACCTGAAGGAGAATCTGC
Reverse primer: TTCTTCGAATCATCTGGCC
Probe:
Amplicon:
Annealing temperature: 60
Complete information for ITGB3 gene (protein-coding), integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
The world's first wiki where authorship really matters. Due credit and reputation for ... The integrin beta3 (ITGB3) and serotonin transporter (SLC6A4) genes were both recently ...
OMIM: 173470 MGI: 96612 HomoloGene: 55444 GeneCards: ITGB3 Gene ... a protein that in humans is encoded by the ITGB3 gene.[1] CD61 is a cluster of differentiation found on ...
A nonsynonymous SNP in the ITGB3 gene disrupts the conserved membrane-proximal cytoplasmic salt bridge in the IIbĪ²3 integrin and cosegregates dominantly ...
A single-nucleotide polymorphism in the human ITGB3 gene is associated with the platelet-specific alloantigen Va (HPA-17bw) involved in fetal maternal ...
Edit this page in Wiki Genes - ITGB3 or see Wiki Gene. Adhesion occurred in part through the CD61/ CD51 ... ITGA2 and ITGB3 polymorphisms were determined by 5'-nuclease assays. ...
The Leu33Pro polymorphism in the ITGB3 gene does not modify BRCA1/2 ... There was marginal evidence that the ITGB3 polymorphism was associated with an increased risk of ovarian ...
The integrin beta3 (ITGB3) and serotonin transporter (SLC6A4) genes were both recently ... the integrin-beta3 gene (ITGB3), an integrin gene within an asthma ...
Human gene symbol report page for 'ITGB3 - integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)
A single-nucleotide polymorphism in the human ITGB3 gene is associated with the platelet-specific alloantigen Vaa (HPA-17bw) involved in fetal ...
Although over 200 candidate gene studies for asthma and atopy have been ... We examined 19 SNPs spanning the ITGB3 gene for association with phenotypes related to ...
Association and gene-gene interaction of SLC6A4 and ITGB3 in autism. ... Gene-gene joint effect was tested by extended multifactor dimensionality ...
PFGE genomic and YAC clone analysis showed that the ITGB3 gene is distal and 365 kb or more upstream of ... and GPIIIa (ITGB3) genes are point mutations: 10 in ITGB3 and 12 in ...
Search Term: ITGB3 (gene) Print page. Overview NextBio Users. No ... Complete your user profile with your interests, if you want others to find you ...
[ Association of the integrin gene polymorphisms with ischemic stroke ... The distributions of the ITGB3 gene T176C polymorphism were not different between the ...