interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST)
Name: IL6ST
Description: interleukin 6 signal transducer (gp130, oncostatin M receptor)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 5
GeneticSource: genomic
MapLocation: 5q11
OtherAliases: CD130, CDw130, GP130, GP130-RAPS, IL6R-beta
OtherDesignations: CD130 antigen|IL6ST nirs variant 3|OTTHUMP00000122545|gp130 of the rheumatoid arthritis antigenic peptide-bearing soluble form|gp130 transducer chain|interleukin 6 signal transducer|interleukin receptor beta chain|membrane glycoprotein gp130|oncostatin M receptor
NomenclatureSymbol: IL6ST
NomenclatureName: interleukin 6 signal transducer (gp130, oncostatin M receptor)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 32606
Summary: The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggested a critical role of the gene encoding this protein in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq]
ChrSort: 05
ChrStart: 55236693
UniProtein db: IL6ST UniProt protein knowledge database
Ensembl db: IL6ST Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for IL6ST
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: IL6ST Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTGTATCACAGACTGGCAACAAG
Reverse primer: GCATTTGCTCTCTGCTAAGTTCC
Probe:
Amplicon:
Annealing temperature: 60
Application: IL6ST Gene Expression Quantification/Detection Taqman PCR
Forward primer: AACACTTCGAGCACTGTCCAG
Reverse primer: AGAAGACTTGGACTGACGGAAC
Probe: ACCGTGGTACACAGTGGCTACAGACACC
Amplicon:
Annealing temperature: 60
Complete information for IL6ST gene (protein-coding), interleukin 6 signal transducer (gp130, oncostatin M receptor)
Glycoprotein 130 (also known as gp130, IL6ST, IL6-beta or CD130) is a transmembrane ... Human gp130 transducer chain gene (IL6ST) is localized to chromosome ...
[IL6ST] The protein encoded by this gene is a signal transducer shared ... Alternative mRNA variants and regulation: The gene contains 25 different gt-ag introns. ...
Mouse Il6st Chr13:113254317-113297049 bp, + strand has data for genome coordinates, mammalian orthology, sequences, phenotypes, polymorphisms, SNPs, ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
We also sequenced the IL6ST gene in 22 individuals from PCA families ... No alteration was found in the coding sequence of IL6ST for these eight families. ...
Human genetic association of polymorphisms in the IL6ST/gp130 gene ... Only SNPs with a minor allele frequency 5% for the IL6ST gene and flanking SNP were selected. ...
Gene: IL6ST. interleukin 6 signal transducer (gp130, oncostatin M receptor) Overview ... CD130 antigen, IL6ST nirs variant 3, gp130 of the rheumatoid ...
Histogram - Click for a histogram of the full gene sequence and mutation details. ... Publications - Click for a complete list of curated publications for IL6ST ...
Formerly known as Obesity Research, Obesity is the official journal of The Obesity ... The IL6ST gene—located on chromosome 5—includes 17 exons encompassing 54 kilobase (kb) ...
IL6ST contributes to AblPP-induced cell detachment. Based on the pathway analysis of the shRNA screening ... to target the IL6ST gene sequence (1273CATACTCAAGGCTACAGAACT1293) ...
Kidd et al. (1992) concluded that there are 2 functional genes for IL6ST. ... to a pseudogene (on chromosome 17) and the functional gene on chromosome 5. By fluorescence in situ ...
Human Gene Features [ORF/cDNA Clones Available in 80 Vector Systems] ... A0003. Gene Symbol. IL6ST. Description. Human interleukin 6 signal transducer (gp130, ...
genes for functions that are necessary in cell detachment induced by a constitutively ... to validate the IL6ST out of the candi- date genes, because it has ...
Project 5 > Association analyses > gene IL6ST. Phenotype-genotype association analysis results for SNPs in Interleukin 6 signal transducer (gp130, ...