interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST)

Name: IL6ST
Description: interleukin 6 signal transducer (gp130, oncostatin M receptor)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 5
GeneticSource: genomic
MapLocation: 5q11
OtherAliases: CD130, CDw130, GP130, GP130-RAPS, IL6R-beta
OtherDesignations: CD130 antigen|IL6ST nirs variant 3|OTTHUMP00000122545|gp130 of the rheumatoid arthritis antigenic peptide-bearing soluble form|gp130 transducer chain|interleukin 6 signal transducer|interleukin receptor beta chain|membrane glycoprotein gp130|oncostatin M receptor
NomenclatureSymbol: IL6ST
NomenclatureName: interleukin 6 signal transducer (gp130, oncostatin M receptor)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 32606
Summary: The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggested a critical role of the gene encoding this protein in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq]
ChrSort: 05
ChrStart: 55236693

UniProtein db: IL6ST UniProt protein knowledge database
Ensembl db: IL6ST Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for IL6ST
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: IL6ST Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTGTATCACAGACTGGCAACAAG
Reverse primer: GCATTTGCTCTCTGCTAAGTTCC
Probe:
Amplicon:
Annealing temperature: 60

Application: IL6ST Gene Expression Quantification/Detection Taqman PCR
Forward primer: AACACTTCGAGCACTGTCCAG
Reverse primer: AGAAGACTTGGACTGACGGAAC
Probe: ACCGTGGTACACAGTGGCTACAGACACC
Amplicon:
Annealing temperature: 60

IL6ST news
Related resources on IL6ST