immunoglobulin heavy joining 5 (IGHJ5)
Name: IGHJ5
Description: immunoglobulin heavy joining 5
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 14
GeneticSource: genomic
MapLocation: 14q32.33
OtherAliases: JH5b
OtherDesignations:
NomenclatureSymbol: IGHJ5
NomenclatureName: immunoglobulin heavy joining 5
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 637
Summary:
ChrSort: 14
ChrStart: 106330021
UniProtein db: IGHJ5 UniProt protein knowledge database
Ensembl db: IGHJ5 Ensembl genome database
Complete information for IGHJ5 gene (uncategorized), immunoglobulin heavy joining 5
Human gene symbol report page for 'IGHJ5 - immunoglobulin heavy joining 5'
or "-" indicates if the gene sequences have been found (+) or not ... genomic DNA or cDNA and the corresponding germline gene has not yet been isolated. ...
IMGT, the international ImMunoGeneTics information system for immunoglobulins or antibodies, T cell receptors, MHC, immunoglobulin superfamily IgSF and MhcSF. ...
... gene name nomenclature. the name of the J-GENE and ALLELE according to the IMGT gene name ... 06, IGHJ5*02 tgtgcgagagggggggctaaggtcgaatttttggagtggtttcatgggtactggttcgacccctgg ...
Determination of IGHV, IGKV, and IGLV gene mutational status ... The use of IGHJ genes was also heterogeneous with 6 cases using IGHJ4, 1 using IGHJ5, and 2 using IGHJ6. ...
Gene Association Results Summary for AY885189. GC Gene. GC ID. UniGene ... IGHJ5. IGH_. 28475. GC14M105400. IGHJ6. IGH_. 3507. GC14M105248. IGHM. IGH_. 28401. GC14M105549 ...
Gene Association Results Summary for BX385593. GC Gene. GC ID. UniGene ... IGHJ5. IGH_. 28475. GC14M105400. IGHJ6. IGH_. 3507. GC14M105248. IGHM. IGH_. 28401. GC14M105549 ...
To better understand V gene usage, specificity, and clonal origins of IgE Abs in allergic ... nated by IGHJ4*02. Clone 47 used the IGHJ5*01 gene segment. ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
This page is an index of all of the genes currently available in the GeneCards Database. ... to a page that displays all genes in alphabetical order and that you ...
To better understand V gene usage, specificity, and clonal origins of IgE Abs in ... used the IGHV6-1 H chain V gene segment, the only member of the VH6 gene family. ...
To screen for MALT1 gene alterations in MZL, samples from a series of ... MALT1 gene (60F18 and 152M15) and PAC 166G16 containing API2 gene (as described ...
Click on the Approved Gene Symbol to retrieve the complete gene record ... IGHJ5. immunoglobulin heavy joining 5. 14q32.32-q32.33. J00256. NG_001019 ...
Genes in cytogenetic band chr14q32. Full description or abstract. Genes in cytogenetic band ... Gene families. Categorize these 469 genes by gene family. Show 469 ...