immunoglobulin heavy joining 2 (IGHJ2)
Name: IGHJ2
Description: immunoglobulin heavy joining 2
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 14
GeneticSource: genomic
MapLocation: 14q32.33
OtherAliases: JH2
OtherDesignations:
NomenclatureSymbol: IGHJ2
NomenclatureName: immunoglobulin heavy joining 2
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 637
Summary:
ChrSort: 14
ChrStart: 106331406
UniProtein db: IGHJ2 UniProt protein knowledge database
Ensembl db: IGHJ2 Ensembl genome database
Human gene symbol report page for 'IGHJ2 - immunoglobulin heavy joining 2'
FT /allele="IGHJ2*01" FT /gene="IGHJ2" FT /putative_limit="5' side" ... The IG and TR genes have been. studied extensively in IMGT® (http://www.imgt.org) [2] ...
The world's first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
IMGT, the international ImMunoGeneTics information system for immunoglobulins or antibodies, T cell receptors, MHC, immunoglobulin superfamily IgSF and MhcSF. ...
Gene Association Results Summary for S55065. GC Gene. GC ID. UniGene ... IGHJ2. 105402660. 105402713. GC14M105484. IGHJ1. 105402806. 105402816. GC14M105485. IGHD7-27 ...
Chronic lymphocytic leukemias utilizing the VH3-21 gene display highly ... Subsets with restricted immunoglobulin gene rearrangement features indicate a ...
... gene name nomenclature. the name of the J-GENE and ALLELE according to the IMGT gene name ... 7*02,IGHJ2*01 tgtgcgagggatggcagctcttatgcccgcccctactggtacttcgatctctgg > ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
Gene Association Results Summary for AY885189. GC Gene. GC ID. UniGene ... IGHJ2. IGH_. 28480. GC14M105478. IGHJ2P. IGH_. 28479. GC14M105477. IGHJ3. IGH_. 28477. GC14M105480 ...
This page is an index of all of the genes currently available in the GeneCards Database. ... to a page that displays all genes in alphabetical order and that you ...
Click on the Approved Gene Symbol to retrieve the complete gene record ... IGHJ2. immunoglobulin heavy joining 2. 14q32.32-q32.33. J00256. NG_001019 ...
Genes in cytogenetic band chr14q32. Full description or abstract. Genes in cytogenetic band ... Gene families. Categorize these 469 genes by gene family. Show 469 ...
Grouping of IGHJ genes by relative location of W and S motifs ... IGHJ2*01. TGCTACTGGTACTTG. 5' S only. IGHJ3*01. TGATGCTTTTGATGT. 5' S then W. IGHJ3*02 ...
Complete information for Search GeneCards gene (M87789) ... 25 IGHD6-6 IGHD7-27 IGHG1 IGHG3 IGHJ1 IGHJ1P IGHJ2 IGHJ2P IGHJ3 IGHJ3P IGHJ4 IGHJ5 IGHJ6 IGHM IGHV1-12 IGHV1 ...
... 1 A1BG 2 A2M 3 A2MP 9 NAT1 10 NAT2 11 AACP 12 SERPINA3 13 AADAC 14 AAMP 15 AANAT ... 64 ACTBP4 65 ACTBP5 66 ACTBP6 67 ACTBP7 68 ACTBP8 69 ACTBP9 70 ACTC1 ...