heme oxygenase (decycling) 1 (HMOX1)

Name: HMOX1
Description: heme oxygenase (decycling) 1
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 22
GeneticSource: genomic
MapLocation: 22q13.1
OtherAliases: HO-1, HSP32, bK286B10
OtherDesignations: heme oxygenase (decyclizing) 1
NomenclatureSymbol: HMOX1
NomenclatureName: heme oxygenase (decycling) 1
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 118436
Summary: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq]
ChrSort: 22
ChrStart: 35777086

UniProtein db: HMOX1 UniProt protein knowledge database
Ensembl db: HMOX1 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for HMOX1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: HMOX1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AAGATTGCCCAGAAAGCCCTGGAC
Reverse primer: AACTGTCGCCACCAGAAAGCTGAG
Probe:
Amplicon:
Annealing temperature: 60

Application: HMOX1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TTCTCCGATGGGTCCTTACACT
Reverse primer: GGCATAAAGCCCTACAGCAACT
Probe:
Amplicon:
Annealing temperature: 60

Application: HMOX1 Gene Expression Quantification/Detection Taqman PCR
Forward primer: CCACCAAGTTCAAGCAGCTC
Reverse primer: CTGACTGCGGGAGTCATCTC
Probe: ACCGCTCCCGCATGAACTCCC
Amplicon:
Annealing temperature: 60

HMOX1 news
Related resources on HMOX1