major histocompatibility complex, class II, DR alpha (HLA-DRA)
Name: HLA-DRA
Description: major histocompatibility complex, class II, DR alpha
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 6
GeneticSource: genomic
MapLocation: 6p21.3
OtherAliases: DASS-397D15.1, HLA-DRA1
OtherDesignations: HLA class II histocompatibility antigen, DR alpha chain|MHC cell surface glycoprotein|histocompatibility antigen HLA-DR alpha
NomenclatureSymbol: HLA-DRA
NomenclatureName: major histocompatibility complex, class II, DR alpha
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 28632
Summary: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. [provided by RefSeq]
ChrSort: 06
ChrStart: 32407646
UniProtein db: HLA-DRA UniProt protein knowledge database
Ensembl db: HLA-DRA Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for HLA-DRA
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: HLA-DRA Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCATCAAGGGAGTGCGCA
Reverse primer: CTCCATGTGCCTTACAGAGGC
Probe: AAGCAATGCAGCAGAACGCAGGG
Amplicon:
Annealing temperature: 60
Complete information for HLA-DRA gene (protein-coding), major histocompatibility complex, class II, DR alpha
HLA class II histocompatibility antigen, DR alpha chain is a protein that in humans is encoded by the HLA-DRA gene.[1] HLA-DRA encodes the alpha subunit of HLA-DR. ...
HLA-DR is also involved in several autoimmune conditions, disease susceptibility and disease resistance. ... Structure and nucleotide sequence of the heavy chain gene of HLA-DR. ...
Human protein-coding gene HLA-DRA. Represented by 1777 ESTs from 336 cDNA libraries. Corresponds to reference sequence NM_019111.3. [UniGene 910795 - Hs.520048]
Complete information for HLA-DRB1 gene (protein-coding), major histocompatibility complex, class II, DR beta 1
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding ... gene transcription, surface expression and shedding of HLA-DR were ...
Genetic variations in HLA-DRA are associated with susceptibility to ... "Sequence of an HLA-DR alpha-chain cDNA clone and intron-exon organization of the corresponding gene. ...
HLA-DR expression accumulated in vacuoles near the nucleus in HCMV-infected, but ... HLA-DR on stable HLA-DR–transfected U373 cells is mediated by the HCMV gene US2, ...
Association Between HLA-DM and HLA-DR In Vivo. Frances Sanderson, ... by a gene linked to conven- tional class II loci, HLA-DR, HLA-DQ, and HLA-DP (Kelly ...
The HLA gene family provides instructions for making a group of ... HLA is the human version of the major histocompatibility complex (MHC), a gene family ...
The genomic organization of the HLA-DR genes, in the human MHC locus ... DR serological families which are encoded by the HLA-DRB3/4/5 gene and the HLA-DRB1 gene, respectively. ...
Gene overview of all published MS-association studies for HLA-DRA ... antigen, DR alpha chain; MHC cell surface glycoprotein; histocompatibility antigen HLA-DR alpha) ...
The above gene assignment was based on the following list of GenBank sequences (GenBank Release 94) ... Human gene for HLA-DR alpha heavy chain a class II ...
BioInfoBank Library :: HLA-DR Antigens :: biosynthesis :: M. avium binding to HLA-DR expressed alleles in silico: a model of phenotypic susceptibility to ...