major histocompatibility complex, class II, DR alpha (HLA-DRA)

Name: HLA-DRA
Description: major histocompatibility complex, class II, DR alpha
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 6
GeneticSource: genomic
MapLocation: 6p21.3
OtherAliases: DASS-397D15.1, HLA-DRA1
OtherDesignations: HLA class II histocompatibility antigen, DR alpha chain|MHC cell surface glycoprotein|histocompatibility antigen HLA-DR alpha
NomenclatureSymbol: HLA-DRA
NomenclatureName: major histocompatibility complex, class II, DR alpha
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 28632
Summary: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. [provided by RefSeq]
ChrSort: 06
ChrStart: 32407646

UniProtein db: HLA-DRA UniProt protein knowledge database
Ensembl db: HLA-DRA Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for HLA-DRA
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: HLA-DRA Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCATCAAGGGAGTGCGCA
Reverse primer: CTCCATGTGCCTTACAGAGGC
Probe: AAGCAATGCAGCAGAACGCAGGG
Amplicon:
Annealing temperature: 60

HLA-DRA news
Related resources on HLA-DRA