glycoprotein (transmembrane) nmb (GPNMB)

Name: GPNMB
Description: glycoprotein (transmembrane) nmb
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 7
GeneticSource: genomic
MapLocation: 7p15
OtherAliases: HGFIN, NMB
OtherDesignations: glycoprotein NMB|glycoprotein nmb-like protein|osteoactivin|transmembrane glycoprotein
NomenclatureSymbol: GPNMB
NomenclatureName: glycoprotein (transmembrane) nmb
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 6274
Summary: The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]
ChrSort: 07
ChrStart: 23286315

UniProtein db: GPNMB UniProt protein knowledge database
Ensembl db: GPNMB Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for GPNMB
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: GPNMB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AAGTGAAAGATGTGTACGTGGTAACAG
Reverse primer: TCGGATGAATTTCGATCGTTCT
Probe:
Amplicon:
Annealing temperature: 60

GPNMB news
Related resources on GPNMB