gastrin (GAST)

Name: GAST
Description: gastrin
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21
OtherAliases: GAS
OtherDesignations:
NomenclatureSymbol: GAST
NomenclatureName: gastrin
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 20309
Summary: Gastrin is a hormone whose main function is to stimulate secretion of hydrochloric acid by the gastric mucosa, which results in gastrin formation inhibition. This hormone also acts as a mitogenic factor for gastrointestinal epithelial cells. Gastrin has two biologically active peptide forms, G34 and G17. [provided by RefSeq]
ChrSort: 17
ChrStart: 39868612

UniProtein db: GAST UniProt protein knowledge database
Ensembl db: GAST Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for GAST
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: GAST Gene Expression Quantification/Detection Taqman PCR
Forward primer: GATCTTTGCACTGGCTCTGG
Reverse primer: GTACCTAAGGGTGCATCTGGC
Probe: AAGCTTCTTGGAAGCCCCGCTCC
Amplicon:
Annealing temperature: 60

GAST news
Related resources on GAST