gastrin (GAST)
Name: GAST
Description: gastrin
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21
OtherAliases: GAS
OtherDesignations:
NomenclatureSymbol: GAST
NomenclatureName: gastrin
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 20309
Summary: Gastrin is a hormone whose main function is to stimulate secretion of hydrochloric acid by the gastric mucosa, which results in gastrin formation inhibition. This hormone also acts as a mitogenic factor for gastrointestinal epithelial cells. Gastrin has two biologically active peptide forms, G34 and G17. [provided by RefSeq]
ChrSort: 17
ChrStart: 39868612
UniProtein db: GAST UniProt protein knowledge database
Ensembl db: GAST Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for GAST
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: GAST Gene Expression Quantification/Detection Taqman PCR
Forward primer: GATCTTTGCACTGGCTCTGG
Reverse primer: GTACCTAAGGGTGCATCTGGC
Probe: AAGCTTCTTGGAAGCCCCGCTCC
Amplicon:
Annealing temperature: 60
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
OMIM: 137250 MGI: 104768 HomoloGene: 628 GeneCards: GAST Gene ... Angiotensin · Bombesin · Calcitonin gene-related peptide · Carnosine · Cocaine and amphetamine regulated ...
OMIM: 137250 MGI: 104768 HomoloGene: 628 GeneCards: GAST Gene ... Angiotensin · Bombesin · Calcitonin gene-related peptide · Carnosine · Cocaine and amphetamine regulated ...
GAST (gibberellin (GA)-stimulated transcript) gene family has been reported in ... ( 1992) originally characterized the GAST1 gene from tomato as related to a GA ...
SNP linked to Gene GAST(geneID:2520) Via Contig Annotation ... Total gene model (contig mRNA transcript): 1. mrna. transcript. protein. mrna orientation ...
Gast Sales company profile in Watertown, SD. Our free company profile report for Gast Sales includes business information such as contact, sales and financial data.
Portrait of the Gast Genes — Dilute the Ugly Gene Challenge TS2 - Community Challenges
GAST-like genes with this putative signal peptide include the GIP1 ... GAST-like proteins have been shown to be present in distant species, various ...
GAST gene expression is upregulated in non-small cell lung cancer. ... Gene promoter methylation in saliva as a biomarker in head and neck cancer ...
Kato et al. (1983) independently cloned human GAST from gastric antrum mRNA. ... GENE STRUCTURE Wiborg et al. (1984) and Ito et al. (1984) determined that the GAST gene ...
Six novel GAST-like genes in rice and 10 members of the gene family in maize, ... The GAST-like gene superfamily encodes small polypeptides that are ...
Quad Cities Dining Guide ( More). Classes. ... E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z | 0-9. Music Classes. Gene Gast Music. Address: ...
ESTRIBOU, GENE + JP PICKENS,Intensification,Onlineshop for psychedelic, progressive and alternative music CDs, LPs, magazines, spec. american imports
Conventus ermöglicht es Ihnen, die Veranstaltung als Gast zu genießen und den Teilnehmern ein Erlebnis zu gestalten. ... Development Genes and Evolution ...
Newark Ohio News - newarkadvocate.com is the home page of Newark Ohio ... Edwin "Gene" Gast. NEWARK: A funeral service for Gene Gast will be held 11:00 a.m. Wednesday at Brucker ...