ferritin, light polypeptide (FTL)

Name: FTL
Description: ferritin, light polypeptide
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 19
GeneticSource: genomic
MapLocation: 19q13.33
OtherAliases: MGC71996
OtherDesignations: ferritin L subunit|ferritin L-chain|ferritin light chain|ferritin light polypeptide-like 3
NomenclatureSymbol: FTL
NomenclatureName: ferritin, light polypeptide
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 24273
Summary: This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq]
ChrSort: 19
ChrStart: 49468565

UniProtein db: FTL UniProt protein knowledge database
Ensembl db: FTL Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for FTL
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: FTL Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATTTCGACCGCGATGATGTGG
Reverse primer: GAACCCAGGGCATGAAGATCC
Probe:
Amplicon:
Annealing temperature: 55

FTL news
Related resources on FTL