ferritin, light polypeptide (FTL)
Name: FTL
Description: ferritin, light polypeptide
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 19
GeneticSource: genomic
MapLocation: 19q13.33
OtherAliases: MGC71996
OtherDesignations: ferritin L subunit|ferritin L-chain|ferritin light chain|ferritin light polypeptide-like 3
NomenclatureSymbol: FTL
NomenclatureName: ferritin, light polypeptide
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 24273
Summary: This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq]
ChrSort: 19
ChrStart: 49468565
UniProtein db: FTL UniProt protein knowledge database
Ensembl db: FTL Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for FTL
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: FTL Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATTTCGACCGCGATGATGTGG
Reverse primer: GAACCCAGGGCATGAAGATCC
Probe:
Amplicon:
Annealing temperature: 55
Complete information for FTL gene (protein-coding), ferritin, light polypeptide
FTL is the gene's official symbol. The FTL gene is also known by other names, listed ... The FTL gene provides instructions for making the ferritin light ...
This gene encodes the light subunit of the ferritin protein. ... Mutations of the FTL gene cause the rare adult-onset basal ganglia disease also ...
[FTL] This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. ...
The information on this page is seed content provided by an organization. Please help ... The FTL gene provides instructions for making the ferritin light chain, which is ...
Gene symbol. Chromosomal location. Gene name. Log in. FTL. 19q13.3-q13.4 ... Gene Symbol. Chromosomal location. Gene name. Log in. FTL. 19q13.3-q13.4. Ferritin, light chain ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
FTL; Ferritin, light polypeptide (19q13.3-q13.4) FTL Menu. Summary ... Medline for related articles (PubMed) Medline Search: cancer AND gene AND FTL[TI] (PubMed) ...
Genes > FTL > Research Resources - Tools for researchers. These resources supplement the information in the Genetics Home Reference gene summary on the FTL gene. ...
Observational study of genotype prevalence and gene-disease association. ... FTL is a marker gene useful for stratifying osteosarcoma patients into low- and high-risk groups and ...
Unbound MEDLINE | Exclusion of mutations in the PRNP, JPH3, TBP, ATN1, CREBBP, POU3F2 and FTL genes as a cause of disease in Portuguese patients with a Huntington ...
In this study, we performed a molecular study of the PANK2, FTL and FTH genes in a family with PKAN classic phenotype. The patient originated from Southern Italy. ...
However, gene expression analysis of iron management proteins in the liver of Tg mice indicates that the FTL-Tg mouse liver is iron deficient. ...
[FTL] This gene encodes the light subunit of the ferritin protein. ... The FTL gene provides instructions for making the ferritin light chain, which is one part (subunit) of a ...
Human gene symbol report page for 'FTL - ferritin, light polypeptide'