FK506 binding protein 12-rapamycin associated protein 1 (FRAP1)
Name: MTOR
Description: mechanistic target of rapamycin (serine/threonine kinase)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 1
GeneticSource: genomic
MapLocation: 1p36.2
OtherAliases: FLJ44809, FRAP, FRAP1, FRAP2, RAFT1, RAPT1
OtherDesignations: FK506 binding protein 12-rapamycin associated protein 1|FK506 binding protein 12-rapamycin associated protein 2|FKBP-rapamycin associated protein|FKBP12-rapamycin complex-associated protein 1|mammalian target of rapamycin|rapamycin and FKBP12 target 1|rapamycin associated protein FRAP2|rapamycin target protein
NomenclatureSymbol: MTOR
NomenclatureName: mechanistic target of rapamycin (serine/threonine kinase)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 78895
Summary: The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq]
ChrSort: 01
ChrStart: 11166587
UniProtein db: FRAP1 UniProt protein knowledge database
Ensembl db: FRAP1 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for FRAP1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: FRAP1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AGGCCGCATTGTCTCTATCAA
Reverse primer: GCAGTAAATGCAGGTAGTCATCCA
Probe:
Amplicon:
Annealing temperature: 60
The world's first wiki where authorship really matters. Due credit and reputation for ... gene at human chromosome 1p36.22 was located within intron 28 of FRAP1 gene encoding ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
Complete information for MTOR gene (protein-coding), FK506 binding protein 12-rapamycin associated protein 1 ... Monoclonal and Polyclonal Antibodies from Abnova (FRAP1) ...
OMIM: 601231 MGI: 1928394 HomoloGene: 3637 GeneCards: FRAP1 Gene ... also known as FK506 binding protein 12-rapamycin associated protein 1 (FRAP1) ...
[FRAP1] The protein encoded by this gene belongs to a family of phosphatidylinositol ... The sequence of this gene is defined by 392 GenBank accessions from 359 cDNA ...
A map of the genomic organization of the human FRAP1 gene can be found at ... The FRAP1 gene encompasses approximatively 156 kb and contains 58 exons. ...
FK506 Binding Protein 12-rapamycin Associated Protein 1 (FRAP1) (Human) antibody ... Gene: FK506 Binding Protein 12-rapamycin Associated Protein 1 (FRAP1) Gene ...
A map of the genomic organization of the human FRAP1 gene can be found at http://www.ncbi.nlm.nih.gov ... The FRAP1 gene encompasses approximatively 156 kb and contains 58 ...
The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. ... Thought leaders and organizations working on research involving FRAP1. ...
Rat Gene Frap1. General Information. All the following links open in a new window: Aliases: ... The annotation for this gene is forthcoming over the next few months. ...
Specific antibody for the gene product of FRAP1, the protein FK506BP 12 ... The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. ...
Gene: FRAP1. FK506 binding protein 12-rapamycin associated protein 1. Overview. Related ... PharmGKB sets gene boundaries by expanding the mRNA boundaries by no ...
The data in COSMIC for FRAP1 is from selected papers only and does not represent a wide survey of publications for this gene. Small Intragenic Mutation Summary ...
FRAP1: FK506 binding protein 12-rapamycin associated protein 1 ... If your laboratory has made a plasmid containing this gene, please consider depositing it at Addgene. ...
FRAP1: FK506 binding protein 12-rapamycin associated protein 1 ... like to receive an email alert whenever other plasmids containing this gene become available, click here. ...