ets variant 4 (ETV4)
Name: ETV4
Description: ets variant 4
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21
OtherAliases: E1A-F, E1AF, PEA3, PEAS3
OtherDesignations: E1A enhancer binding protein|EWS protein/E1A enhancer binding protein chimera|ets variant gene 4 (E1A enhancer binding protein, E1AF)|ets variant gene 4 (E1A enhancer-binding protein, E1AF)|polyomavirus enhancer activator-3
NomenclatureSymbol: ETV4
NomenclatureName: ets variant 4
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 13598
Summary:
ChrSort: 17
ChrStart: 41605210
UniProtein db: ETV4 UniProt protein knowledge database
Ensembl db: ETV4 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for ETV4
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: ETV4 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AGAGCTTTAAGCAAGAATACCATGATC
Reverse primer: GGGTACCTGTGCCCATTGAC
Probe:
Amplicon:
Annealing temperature: 60
"Entrez Gene: ETV4 Ets variant gene 4 (E1A enhancer binding protein, ... 22 genes from chromosome 17q21: cloning, sequencing, and characterization of mutations in breast cancer ...
TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. ... studies and identified marked overexpression of ETV4 in 2 of 98 cases. ...
TMPRSS2:ETV4 Gene Fusions Define a Third Molecular Subtype ... gene expression data, the ETS family transcription factors ERG and. ETV1 were identified ...
ETV4; ETS variant gene 4 (E1A enhancer-binding protein, E1AF) (17q21) ... Medline Search: cancer AND gene AND (ETV4[TI] OR E1A-F[TI] OR E1AF[TI]) (PubMed) ...
Mouse Etv4 Chr11:101631061-101646685 bp, - strand has data for genome ... ets variant gene 4 (E1A enhancer binding protein, E1AF) MGI:99423. Nomenclature History ...
The protein encoded by the ETV4 gene is known to play a role in ovarian and breast malignancies as well as in ... ETV4, ets variant gene 4 (E1A enhancer binding protein, E1AF) ...
But the new ETV4 gene has two important differences from the ETV1 and ERG genes. ... Second, the over-expressed ETV4 gene appeared in two prostate cancer patients in ...
Another gene rearrangement involved in prostate cancer identified ... But the new ETV4 gene has two important differences from the ETV1 and ERG genes. ...
Recurrent gene fusions between the androgen-regulated gene TMPRSS2 and the ETS ... Rhodes DR, et al. TMPRSS2:ETV4 gene fusions define a third molecular ...
Gene: ETV4 (ENSG00000175832) ETS translocation variant 4 (Adenovirus E1A enhancer-binding ... Gene views which provide displays for data associated at the gene level such as ...
expression of ETS-gene fusions in subsets of prostate cancers. ... region of the TMPRSS2 gene and the ERG, ETV1 or ETV4. genes, resulting in overexpression of normal or ...
Researchers have identified a third gene involved in prostate cancer, expanding ... The ETV4 gene is a member of the same family as the two other genes, ETV1 and ERG, ...
Etv4 (M.musculus) Subscribe to Addgene Alerts: If you would like to receive an email alert whenever other plasmids containing this gene become available, click here. ...
Novel recurrent gene fusions between the androgen-regulated gene TMPRSS2 and the ... The frequency of ETV4 gene fusion as reported previously is also rare.2 ...
The ETV4 gene is a member of the same family as the two other genes, ETV1 and ERG, reported earlier. ... Like other family members, ETV4 has a role in normal cell division ...