ets variant 4 (ETV4)

Name: ETV4
Description: ets variant 4
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q21
OtherAliases: E1A-F, E1AF, PEA3, PEAS3
OtherDesignations: E1A enhancer binding protein|EWS protein/E1A enhancer binding protein chimera|ets variant gene 4 (E1A enhancer binding protein, E1AF)|ets variant gene 4 (E1A enhancer-binding protein, E1AF)|polyomavirus enhancer activator-3
NomenclatureSymbol: ETV4
NomenclatureName: ets variant 4
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 13598
Summary:
ChrSort: 17
ChrStart: 41605210

UniProtein db: ETV4 UniProt protein knowledge database
Ensembl db: ETV4 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ETV4
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ETV4 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AGAGCTTTAAGCAAGAATACCATGATC
Reverse primer: GGGTACCTGTGCCCATTGAC
Probe:
Amplicon:
Annealing temperature: 60

ETV4 news
Related resources on ETV4