excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing) (ERCC3)
Name: ERCC3
Description: excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 2
GeneticSource: genomic
MapLocation: 2q21
OtherAliases: BTF2, GTF2H, RAD25, TFIIH, XPB
OtherDesignations: excision repair cross-complementing rodent repair deficiency, complementation group 3|xeroderma pigmentosum, complementation group B
NomenclatureSymbol: ERCC3
NomenclatureName: excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 18391
Summary: ERCC3 is an ATP-dependent DNA helicase that functions in nucleotide excision repair and complements xeroderma pigmentosum group B mutations. It also is the 89 kDa subunit of basal transcription factor 2 (TFIIH) and thus functions in class II transcription. [provided by RefSeq]
ChrSort: 02
ChrStart: 128014865
UniProtein db: ERCC3 UniProt protein knowledge database
Ensembl db: ERCC3 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for ERCC3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: ERCC3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCGGCAGAGATTCTTGGTAGA
Reverse primer: TGTCGAAAACGCCAAGTCTTC
Probe:
Amplicon:
Annealing temperature: 60
Complete information for ERCC3 gene (protein-coding), excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma...
Gene 138 (1-2): 171–4. doi:10.1016/0378-1119(94)90802-8. PMID 8125298. Drapkin R, Reardon JT, Ansari A, et al. ... with mutations in the DNA repair and transcription gene ERCC3. ...
Localization of the xeroderma pigmentosum group B-correcting gene ERCC3 to human chromosome 2q21. ... The gene encodes a presumed DNA and chromatin binding helicase, involved in ...
The intriguing involvement of the ERCC3 protein in the vital process of ... Molecular analysis of the ERCC3 gene in both patients revealed a single base ...
The gene encodes a presumed DNA and chromatin binding helicase, involved in early steps of the excision ... 2 and in situ hybridization with fluorescently labeled ERCC3 probes. ...
Newly identified CHO ERCC3/XPB mutations and phenotype characterization ... The hamster ERCC3 gene shows high degree of homology with the human ERCC3/XPB gene. ...
Seven of the genes are involved in processes of nucleotide excision repair, NER. ... XPB (ERCC3): The XPB complementation group of XP is the result of defects in the ERCC3 gene. ...
The XPB/ERCC3 gene corrects the nucleotide excisionrepair defect in ... The XPB/ERCC3 protein is synthesized at a relatively high level in baculovirus ...
Hall, H (Hana) :: Phosphorylation of RNA polymerase II CTD regulates H3 methylation in ... hamster ERCC3 gene is the homologue of the human XPB gene) are a unique resource for ...
The predicted amino acid sequence of the vaccinia virus gene A18R shows significant homology to the human ERCC3 gene product, which is a member of the DEXH subfamily ...
Entry selected based on evidence linking the gene product to a pathway or mechanism linked to ageing ... Mutations in ERCC3 cause Xeroderma Pigmentosum group B [0547] ...
ERCC3 is involved in initiation of basal transcription and global genome repair as well ... The hamster ERCC3 gene shows high degree of homology with the human ERCC3/XPB gene. ...
The world's first wiki where authorship really matters. Due credit and reputation for ... Chromosome 2 corrected UV24, and the gene responsible was designated ERCC3 [5] ...
Gene name. Log in. ERCC3. 2q21. Excision repair cross-complementing rodent repair deficiency, ... Gene name. Log in. ERCC3. 2q21. Excision repair cross-complementing ...
Histogram - Click for a histogram of the full gene sequence and mutation details. ... Publications - Click for a complete list of curated publications for ERCC3 ...