excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing) (ERCC3)

Name: ERCC3
Description: excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 2
GeneticSource: genomic
MapLocation: 2q21
OtherAliases: BTF2, GTF2H, RAD25, TFIIH, XPB
OtherDesignations: excision repair cross-complementing rodent repair deficiency, complementation group 3|xeroderma pigmentosum, complementation group B
NomenclatureSymbol: ERCC3
NomenclatureName: excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 18391
Summary: ERCC3 is an ATP-dependent DNA helicase that functions in nucleotide excision repair and complements xeroderma pigmentosum group B mutations. It also is the 89 kDa subunit of basal transcription factor 2 (TFIIH) and thus functions in class II transcription. [provided by RefSeq]
ChrSort: 02
ChrStart: 128014865

UniProtein db: ERCC3 UniProt protein knowledge database
Ensembl db: ERCC3 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ERCC3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ERCC3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCGGCAGAGATTCTTGGTAGA
Reverse primer: TGTCGAAAACGCCAAGTCTTC
Probe:
Amplicon:
Annealing temperature: 60

ERCC3 news
Related resources on ERCC3