endoglin (ENG)
Name: ENG
Description: endoglin
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 9
GeneticSource: genomic
MapLocation: 9q33-q34.1
OtherAliases: RP11-228B15.2, CD105, END, FLJ41744, HHT1, ORW, ORW1
OtherDesignations: CD105 antigen
NomenclatureSymbol: ENG
NomenclatureName: endoglin
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 51965
Summary: This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds TGFB1 and TGFB3 with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]
ChrSort: 09
ChrStart: 130577290
UniProtein db: ENG UniProt protein knowledge database
Ensembl db: ENG Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for ENG
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: ENG Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CAACATGCAGATCTGGACCAC
Reverse primer: CTTTAGTACCAGGGTCATGGC
Probe:
Amplicon:
Annealing temperature: 55
The ENG gene is also known by other names, listed below. What is the normal function of the ENG gene? ... The ENG gene belongs to a family of genes called CD (CD molecules) ...
Complete information for ENG gene (protein-coding), endoglin
The world's first wiki where authorship really matters. Due credit and reputation for ... malformations and resulting from mutations in two major genes: ENG and ACVRL1 [2] ...
ENG is the gene's official symbol. The ENG gene is also known by other names, listed ... The ENG gene belongs to a family of genes called CD (CD molecules) ...
Polymorphisms in transforming growth factor-beta-related genes ALK1 and ENG are associated with sporadic brain arteriovenous malformations. Stroke. ...
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
ENG - endoglin (Osler-Rendu-Weber syndrome 1) - Bioportfolio ... Gene Information from Publications. Publication Link. Summary of findings. 18156205. oxygen regulates the ...
ENG: Gene therapy is found useful to improve vision. Message List ... If that gene could be replaced before the visual apparatus deteriorates from lack of use, then vision could ...
Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. ... The disease is caused by mutations of two genes: ENG and ALK1 (ACVRL1) ...
ENG: Gene therapy news - Ocular gene therapy trials for Leber congen ... It is hugely encouraging to see that gene-replacement therapy for RPE65 can be effective, ...
Mutations in the ENG gene and ALK1 (ACVRL1) gene cause HHT1 and HHT2 respectively. ... In the ENG gene 112 probands showed 69 different pathogenic mutations. ...
This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of ... Search Term: ENG (gene) Print page. Overview. endoglin. This gene encodes a homodimeric ...
HHT Solutions seeks to identify the precise mutation in a gene that causes illness in a specific family ... to sections of the ENG gene and ALK1 gene in a sequential order ...
Microdeletion at 9q33.3q34.11 encompassing the LMX1B and ENG genes: a case report. ... Approximately 15% of cases involve a deletion of a part or of the entire gene. ...