endoglin (ENG)

Name: ENG
Description: endoglin
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 9
GeneticSource: genomic
MapLocation: 9q33-q34.1
OtherAliases: RP11-228B15.2, CD105, END, FLJ41744, HHT1, ORW, ORW1
OtherDesignations: CD105 antigen
NomenclatureSymbol: ENG
NomenclatureName: endoglin
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 51965
Summary: This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds TGFB1 and TGFB3 with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]
ChrSort: 09
ChrStart: 130577290

UniProtein db: ENG UniProt protein knowledge database
Ensembl db: ENG Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ENG
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ENG Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CAACATGCAGATCTGGACCAC
Reverse primer: CTTTAGTACCAGGGTCATGGC
Probe:
Amplicon:
Annealing temperature: 55

ENG news
Related resources on ENG