elastin (ELN)

Name: ELN
Description: elastin
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 7
GeneticSource: genomic
MapLocation: 7q11.23
OtherAliases: FLJ38671, FLJ43523, SVAS, WBS, WS
OtherDesignations: OTTHUMP00000211864|tropoelastin
NomenclatureSymbol: ELN
NomenclatureName: elastin
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 42393
Summary: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]
ChrSort: 07
ChrStart: 73442426

UniProtein db: ELN UniProt protein knowledge database
Ensembl db: ELN Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ELN
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ELN Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCGCTAAGGCAGCCAAGTATGGA
Reverse primer: AGCTCCAACCCCGTAAGTAGGAAT
Probe:
Amplicon:
Annealing temperature: 60

ELN news
Related resources on ELN