elastin (ELN)
Name: ELN
Description: elastin
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 7
GeneticSource: genomic
MapLocation: 7q11.23
OtherAliases: FLJ38671, FLJ43523, SVAS, WBS, WS
OtherDesignations: OTTHUMP00000211864|tropoelastin
NomenclatureSymbol: ELN
NomenclatureName: elastin
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 42393
Summary: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]
ChrSort: 07
ChrStart: 73442426
UniProtein db: ELN UniProt protein knowledge database
Ensembl db: ELN Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for ELN
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: ELN Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCGCTAAGGCAGCCAAGTATGGA
Reverse primer: AGCTCCAACCCCGTAAGTAGGAAT
Probe:
Amplicon:
Annealing temperature: 60
The ELN gene provides instructions for making a protein called elastin. ... Several mutations in the ELN gene have been identified in people with a skin ...
Mouse Eln Chr5:135178466-135223124 bp, - strand has data for genome ... Mice homozygous for a disruption in this gene die postnatally of an obstructive arterial disease. ...
Gene symbol. Chromosomal location. Gene name. Log in. ELN. 7q11.23. Elastin ... Gene Symbol. Chromosomal location. Gene name. Log in. ELN. 7q11.23. Elastin ...
Human protein-coding gene ELN. Represented by 997 ESTs from 201 cDNA libraries. ... Tissues and development stages from this gene's sequences survey gene expression. ...
Gene: ELN (ENSG00000049540) Elastin Precursor (Tropoelastin) Source: ... in this gene: Name. Transcript ID. Protein ID. Description. ELN-001. ENST00000320399 ...
SNP linked to Gene ELN(geneID:2006) Via Contig Annotation. rs# on all gene models to Batch ... Gene Model (mRNA alignment) information from genome sequence ...
Mutations in the Tropoelastin Gene (ELN) Were Not Found in Patients ... The whole coding region of the ELN gene was amplified in a half-nested 2-step ...
Williams syndrome (WS) is caused by deletion of the elastin (ELN) gene.
The ELN gene contains genetic information for making elastin, which is an ... Deletions of the ELN gene may cause connective tissue abnormalities (such as ...
Results—No mutations were found in the whole coding region of the ELN gene. ... Conclusions—Neither mutations in the ELN gene nor dysregulation of its activity ...
Apolipoprotein E (APOE) and elastin (ELN) are plausible candidate genes involved in the pathogenesis of ... APOE, the elastin (ELN) gene emerged as a putative gene for IA after ...
ELN is the gene's official symbol. The ELN gene is located in a region of chromosome 7 that is deleted in ...
Elastin Gene Polymorphisms in Neovascular Age-Related Macular Degeneration and ... The findings implicate ELN as a susceptibility gene for PCV, and suggest that a ...
We have analyzed the ELN gene in. a variety of primate species to determine whether the ... ELN gene is presented in full; in the comparison of this sequence to the ...
Gene: ELN. Transcript: ELN-013. Transcript-based displays. Transcript ... is a product of gene ENSG00000049540 - There are 35 transcripts in this gene: ...