dickkopf homolog 3 (Xenopus laevis) (DKK3)
Name: DKK3
Description: dickkopf homolog 3 (Xenopus laevis)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 11
GeneticSource: genomic
MapLocation: 11p15.2
OtherAliases: REIC, RIG
OtherDesignations: RIG-like 5-6|RIG-like 7-1|dickkopf 3|dickkopf homolog 3|regulated in glioma
NomenclatureSymbol: DKK3
NomenclatureName: dickkopf homolog 3 (Xenopus laevis)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 12148
Summary: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. The expression of this gene is decreased in a variety of cancer cell lines and it may function as a tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq]
ChrSort: 11
ChrStart: 11984542
UniProtein db: DKK3 UniProt protein knowledge database
Ensembl db: DKK3 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for DKK3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: DKK3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AGAGAGGCTTGAGGTGGAAGTG
Reverse primer: CCGGATCCTCTACGCTAATAGC
Probe:
Amplicon:
Annealing temperature: 60
Application: DKK3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCGGGAGCGAGCAGATC
Reverse primer: CCCGACTGGACCGAGTTG
Probe:
Amplicon:
Annealing temperature: 60
Application: DKK3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GAAACTGCTCTGGTCTTCACTAGCT
Reverse primer: CTCCTCGTCCATCAGGGATCT
Probe:
Amplicon:
Annealing temperature: 60
Complete information for DKK3 gene (protein-coding), dickkopf homolog 3 (Xenopus laevis)
Dickkopf-related protein 3 is a protein that in humans is encoded by the DKK3 gene.[1][2] This gene encodes a protein that is a member of the dickkopf family. ...
Mouse Dkk3 Chr7:119259537-119301933 bp, - strand has data for genome coordinates, ...
Gene expression in the mouse brain for the gene Dkk3, also known as 'dickkopf homolog 3 (Xenopus laevis)
Dkk3 • gene expression • neurodevelopment • schizophrenia • Wnt ... Furthermore, using in situ hybridization, Dkk3 mRNA was shown to be abundantly ...
the DKK3 gene was expressed in the ZG at a higher level. than in the ... and the DKK3 gene was independently described as. reduced expression in immortalized cells ...
DKK3 mRNA expression and DKK3 promoter methylation were determined by RT-PCR, ... Our study is the first to analyse DKK3 gene regulation in human breast cancer. ...
DKK3 mRNA expression and DKK3 promoter methylation were determined by RT-PCR, ... Our study is the first to analyse DKK3 gene regulation in human breast cancer. ...
We have therefore generated dkk3 mutant mice by targeted disruption of the gene. ... the notion that dkk3 and p29 represent the same gene under a common promoter, ...
SNP linked to Gene DKK3(geneID:27122) Via Contig Annotation ... Total gene model (contig mRNA transcript): 8. mrna. transcript. protein. mrna orientation ...
We show for the first time that the effects of MT1-MMP on cell invasion are mediated in part through changes in DKK3 gene transcription. Paper-12905288. ...
Identification of Gene Expression Changes Associated with the ... Dkk3 is a member of the dickkopf family of Wnt-signaling regulatory genes50 and ...
Histogram - Click for a histogram of the full gene sequence and mutation details. ... Publications - Click for a complete list of curated publications for DKK3 ...
Reduction of DKK3 in control cells with a short hairpin RNA (shRNA) increases ... Since the PLF1 and DKK3 genes exhibited the greatest changes among candidate ...
Dkk3 is an antagonist of Wnt genes, involved in Wnt signaling pathways. ... Confirmed refers to genes in which multiple lines yield matching datasets that ...