dickkopf homolog 3 (Xenopus laevis) (DKK3)

Name: DKK3
Description: dickkopf homolog 3 (Xenopus laevis)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 11
GeneticSource: genomic
MapLocation: 11p15.2
OtherAliases: REIC, RIG
OtherDesignations: RIG-like 5-6|RIG-like 7-1|dickkopf 3|dickkopf homolog 3|regulated in glioma
NomenclatureSymbol: DKK3
NomenclatureName: dickkopf homolog 3 (Xenopus laevis)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 12148
Summary: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. The expression of this gene is decreased in a variety of cancer cell lines and it may function as a tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq]
ChrSort: 11
ChrStart: 11984542

UniProtein db: DKK3 UniProt protein knowledge database
Ensembl db: DKK3 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for DKK3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: DKK3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AGAGAGGCTTGAGGTGGAAGTG
Reverse primer: CCGGATCCTCTACGCTAATAGC
Probe:
Amplicon:
Annealing temperature: 60

Application: DKK3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCGGGAGCGAGCAGATC
Reverse primer: CCCGACTGGACCGAGTTG
Probe:
Amplicon:
Annealing temperature: 60

Application: DKK3 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GAAACTGCTCTGGTCTTCACTAGCT
Reverse primer: CTCCTCGTCCATCAGGGATCT
Probe:
Amplicon:
Annealing temperature: 60

DKK3 news
Related resources on DKK3