deiodinase, iodothyronine, type III (DIO3)
Name: DIO3
Description: deiodinase, iodothyronine, type III
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 14
GeneticSource: genomic
MapLocation: 14q32
OtherAliases: 5DIII, D3, DIOIII, TXDI3
OtherDesignations: iodothyronine deiodinase, placental type|thyroxine deiodinase type III (selenoprotein)|type 3 iodothyronine selenodeiodinase|type-III 5 deiodinase
NomenclatureSymbol: DIO3
NomenclatureName: deiodinase, iodothyronine, type III
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 6567
Summary: The protein encoded by this intronless gene belongs to the iodothyronine deiodinase family. It catalyzes the inactivation of thyroid hormone by inner ring deiodination of the prohormone thyroxine (T4) and the bioactive hormone 3,3 ,5-triiodothyronine (T3) to inactive metabolites, 3,3 ,5 -triiodothyronine (RT3) and 3,3 -diiodothyronine (T2), respectively. This enzyme is highly expressed in the pregnant uterus, placenta, fetal and neonatal tissues, suggesting that it plays an essential role in the regulation of thyroid hormone inactivation during embryological development. This protein contains a selenocysteine (Sec) residue, which is essential for efficient enzyme activity. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3 UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq]
ChrSort: 14
ChrStart: 102027687
UniProtein db: DIO3 UniProt protein knowledge database
Ensembl db: DIO3 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for DIO3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: DIO3 Gene Expression Quantification/Detection Taqman PCR
Forward primer: GCTTCCAGAGCCAGCACATC
Reverse primer: GCTGCCGAAATTGAGAACCA
Probe: TCGACTACGCGCAAGGGAACCG
Amplicon:
Annealing temperature: 60
Complete information for DIO3 gene (protein-coding), deiodinase, iodothyronine, type III
According to AceView, this gene is well expressed, 0.6 times the average gene in this release. ... Map: This gene DIO3 maps on chromosome 14, at 14q32 according to Entrez Gene. ...
The world's first wiki where authorship really matters. Due credit and reputation for authors. Imagine a ... The human DIO3 gene and its mouse homolog, Dio3, map to chromosomes ...
The gene locus encoding iodothyronine deiodinase type 3 (Dio3) is ... The mouse Dio3 gene and its human homolog map to chromosomal regions that are known to ...
Mouse Dio3 Chr12:111517470-111518918 bp, + strand has data for genome ... Mice homozygous for disruptions in this gene experience partial embryonic or perinatal lethality. ...
Gene Expression from the Imprinted Dio3 Locus Is Associated with Cell Proliferation of ... Interestingly, Dlk1 is another imprinted gene in this domain that is ...
Complete information for DIO3OS gene (RNA gene), DIO3 opposite strand (non-protein coding) ... The mouse Dio3 gene is imprinted from the paternal allele during fetal development, ...
A fraction of mammalian genes, however, is subject to imprinting—a chemical ... all the genes in one genomic region, Dlk1-Dio3, which are imprinted ...
regulation of genes from the imprinted domain of mouse chromosome 12. We compared gene expression ... co-regulation of genes from the Dlk1 – Dio3 imprinted domain ...
The Gene Locus Encoding Iodothyronine Deiodinase Type 3 (Dio3) Is ... The mouse Dio3 gene and its human homolog map to chromosomal regions that are known to ...
DIO3 - deiodinase, iodothyronine, type III - Bioportfolio ... TGF-beta stimulates transcription of the hDio3 gene via a Smad-dependent pathway. ...
HIF transactivates target genes by binding 1 or more hypoxia response elements (HREs) ... of the DIO3 gene (–832 bp relative to the DIO3 transcription start ...
Localization of the type 3 iodothyronine deiodinase (DIO3) gene to human chromosome 14q32 and mouse chromosome 12f1. Auteur(s) / Author(s) HERNANDEZ A. ...
These gene changes may be involved in the regulation of photorefractoriness, as ... 2 deiodinase (Dio2) gene and reduce expression of type 3 deiodinase (Dio3) gene. ...
Coordinated diurnal regulation of genes from the Dlk1–Dio3 imprinted domain: implications for regulation of clusters of non-paralogous genes ...