deiodinase, iodothyronine, type III (DIO3)

Name: DIO3
Description: deiodinase, iodothyronine, type III
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 14
GeneticSource: genomic
MapLocation: 14q32
OtherAliases: 5DIII, D3, DIOIII, TXDI3
OtherDesignations: iodothyronine deiodinase, placental type|thyroxine deiodinase type III (selenoprotein)|type 3 iodothyronine selenodeiodinase|type-III 5 deiodinase
NomenclatureSymbol: DIO3
NomenclatureName: deiodinase, iodothyronine, type III
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 6567
Summary: The protein encoded by this intronless gene belongs to the iodothyronine deiodinase family. It catalyzes the inactivation of thyroid hormone by inner ring deiodination of the prohormone thyroxine (T4) and the bioactive hormone 3,3 ,5-triiodothyronine (T3) to inactive metabolites, 3,3 ,5 -triiodothyronine (RT3) and 3,3 -diiodothyronine (T2), respectively. This enzyme is highly expressed in the pregnant uterus, placenta, fetal and neonatal tissues, suggesting that it plays an essential role in the regulation of thyroid hormone inactivation during embryological development. This protein contains a selenocysteine (Sec) residue, which is essential for efficient enzyme activity. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3 UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq]
ChrSort: 14
ChrStart: 102027687

UniProtein db: DIO3 UniProt protein knowledge database
Ensembl db: DIO3 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for DIO3
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: DIO3 Gene Expression Quantification/Detection Taqman PCR
Forward primer: GCTTCCAGAGCCAGCACATC
Reverse primer: GCTGCCGAAATTGAGAACCA
Probe: TCGACTACGCGCAAGGGAACCG
Amplicon:
Annealing temperature: 60

DIO3 news
Related resources on DIO3