branched chain aminotransferase 1, cytosolic (BCAT1)

Name: BCAT1
Description: branched chain aminotransferase 1, cytosolic
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 12
GeneticSource: genomic
MapLocation: 12p12.1
OtherAliases: BCT1, DKFZp686E12175, ECA39, MECA39, PNAS-121, PP18
OtherDesignations: branched-chain-amino-acid aminotransferase, cytosolic|placental protein 18
NomenclatureSymbol: BCAT1
NomenclatureName: branched chain aminotransferase 1, cytosolic
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 4202
Summary: This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. [provided by RefSeq]
ChrSort: 12
ChrStart: 24964277

UniProtein db: BCAT1 UniProt protein knowledge database
Ensembl db: BCAT1 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for BCAT1
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: BCAT1 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CAACTATGGAGAATGGTCCTAAGCT
Reverse primer: TGTCCAGTCGCTCTCTTCTCTTC
Probe:
Amplicon:
Annealing temperature: 60

BCAT1 news
Related resources on BCAT1