agouti signaling protein, nonagouti homolog (mouse) (ASIP)

Name: ASIP
Description: agouti signaling protein, nonagouti homolog (mouse)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 20
GeneticSource: genomic
MapLocation: 20q11.2-q12
OtherAliases: AGSW, AGTI, AGTIL, ASP, MGC126092, MGC126093, SHEP9
OtherDesignations: agouti signaling protein|agouti switch protein
NomenclatureSymbol: ASIP
NomenclatureName: agouti signaling protein, nonagouti homolog (mouse)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 7685
Summary: In mice, the agouti gene encodes a paracrine signaling molecule that causes hair follicle melanocytes to synthesize pheomelanin, a yellow pigment, instead of the black or brown pigment, eumelanin. Pleiotropic effects of constitutive expression of the mouse gene include adult-onset obesity, increased tumor susceptibility, and premature infertility. This gene is highly similar to the mouse gene and encodes a secreted protein that may (1) affect the quality of hair pigmentation, (2) act as a pharmacological antagonist of alpha-melanocyte-stimulating hormone, (3) play a role in neuroendocrine aspects of melanocortin action, and (4) have a functional role in regulating lipid metabolism in adipocytes. [provided by RefSeq]
ChrSort: 20
ChrStart: 32848170

UniProtein db: ASIP UniProt protein knowledge database
Ensembl db: ASIP Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ASIP
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ASIP Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GTCTTCCTCTGCTTCTTCACTGC
Reverse primer: ATCGGTTTGGATTTCTTGTTCAG
Probe:
Amplicon:
Annealing temperature: 62

ASIP news
Related resources on ASIP