agouti signaling protein, nonagouti homolog (mouse) (ASIP)
Name: ASIP
Description: agouti signaling protein, nonagouti homolog (mouse)
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 20
GeneticSource: genomic
MapLocation: 20q11.2-q12
OtherAliases: AGSW, AGTI, AGTIL, ASP, MGC126092, MGC126093, SHEP9
OtherDesignations: agouti signaling protein|agouti switch protein
NomenclatureSymbol: ASIP
NomenclatureName: agouti signaling protein, nonagouti homolog (mouse)
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 7685
Summary: In mice, the agouti gene encodes a paracrine signaling molecule that causes hair follicle melanocytes to synthesize pheomelanin, a yellow pigment, instead of the black or brown pigment, eumelanin. Pleiotropic effects of constitutive expression of the mouse gene include adult-onset obesity, increased tumor susceptibility, and premature infertility. This gene is highly similar to the mouse gene and encodes a secreted protein that may (1) affect the quality of hair pigmentation, (2) act as a pharmacological antagonist of alpha-melanocyte-stimulating hormone, (3) play a role in neuroendocrine aspects of melanocortin action, and (4) have a functional role in regulating lipid metabolism in adipocytes. [provided by RefSeq]
ChrSort: 20
ChrStart: 32848170
UniProtein db: ASIP UniProt protein knowledge database
Ensembl db: ASIP Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for ASIP
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: ASIP Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GTCTTCCTCTGCTTCTTCACTGC
Reverse primer: ATCGGTTTGGATTTCTTGTTCAG
Probe:
Amplicon:
Annealing temperature: 62
Complete information for ASIP gene (protein-coding), agouti signaling protein, nonagouti homolog (mouse)
[ASIP] In mice, the agouti gene encodes a paracrine signaling molecule that ... This gene is highly similar to the mouse gene and encodes a secreted protein ...
The researchers also studied the ASIP locus in Barbary sheep, an ancient species ... A gene duplication affecting expression of the ovine ASIP gene is ...
In this study, we have tried to determine DNA sequences of the ASIP gene (ASIP) of various simian species to find molecular evolutionary aspects of ASIP [6] ...
In many mammals the ASIP gene is expressed during the middle of the hair cycle ... Genomic structure of the ASIP gene in mice and pigs (after Miltenberger 2002 and ...
Agouti signaling protein (ASIP) was the first "obesity gene" to be cloned and ... The ASIP gene has been characterized in fish, chickens, and various mammals, but no ...
The Agouti Signaling Protein (ASIP) Gene. Answers Research Journal 2 ... Fig. 1. Genomic structure of the ASIP gene in mice and pigs (after Miltenberger 2002 and ...
A gene duplication affecting expression of the ovine ASIP gene is responsible for white and black sheep. Belinda J. Norris1 and Vicki A. Whan ...
We report some of the first evidence that the avian ASIP gene has a role in pigmentation. ... The presence of a functional ASIP gene in birds has been widely ...
The ASIP gene has been characterized in fish, chickens, and various mammals, but ... The deletion – or knockout' – of the ASIP gene may have helped gibbons adapt to ...
4008-ASIP. Cell- and tissue-specific gene expression. 4009-ASIP Redox ... 4107-ASIP. Gene expression and signal transduction in neoplasia. 4108-ASIP. Growth factors, ...
ASIP is an important pigmentation gene responsible for dorsoventral and hair ... We report some of the first evidence that the avian ASIP gene has a ...
Agouti signaling protein (ASIP) was the first "obesity gene" to be cloned and ... The ASIP gene has been characterized in fish, chickens, and various mammals, but no ...
Gene name. Log in. ASIP. 20q11.2-q12. Agouti signaling protein, nonagouti homologue (mouse) ... Gene Symbol. Chromosomal location. Gene name. Log in. ASIP. 20q11.2-q12 ...
4058-ASIP Extracellular matrix - integrin-mediated gene regulation ... 4164-ASIP Gene expression and signal transduction in neoplasia. 4165-ASIP Growth factors, ...