actin, beta (ACTB)

Name: ACTB
Description: actin, beta
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 7
GeneticSource: genomic
MapLocation: 7p15-p12
OtherAliases: PS1TP5BP1
OtherDesignations: PS1TP5-binding protein 1|actin, cytoplasmic 1|beta actin|beta cytoskeletal actin
NomenclatureSymbol: ACTB
NomenclatureName: actin, beta
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 43173
Summary: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. [provided by RefSeq]
ChrSort: 07
ChrStart: 5566778

UniProtein db: ACTB UniProt protein knowledge database
Ensembl db: ACTB Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ACTB
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTGGAACGGTGAAGGTGACA
Reverse primer: AAGGGACTTCCTGTAACAATGCA
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGTGATGGTGGGAATGGGTCAG
Reverse primer: TTTGATGTCACGCACGATTTCC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATAGCACAGCCTGGATAGCAACGTAC
Reverse primer: CACCTTCTACAATGAGCTGCGTGTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TGAGCGCGGCTACAGCTT
Reverse primer: TCCTTAATGTCACGCACGATTT
Probe: ACCACCACGGCCGAGCGG
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: GGCACCCAGCACAATGAAG
Reverse primer: GCCGATCCACACGGAGTACT
Probe: TCAAGATCATTGCTCCTCCTGAGCGC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TGAGCGCGGCTACAGCTT
Reverse primer: TCCTTAATGTCACGCACGATTT
Probe: ACCACCACGGCCGAGCGG
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: GGCACCCAGCACAATGAAG
Reverse primer: GCCGATCCACACGGAGTACT
Probe: CAAGATCATTGCTCCTCCTGAGAGCGC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTGGGAGTGGGTGGAGGC
Reverse primer: TCAACTGGTCTCAAGTCAGTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: AGCGCGGCTACAGCTTCA
Reverse primer: CGTAGCACAGCTTCTCCTTAATGTC
Probe: ATTTCCCGCTCGGCCGTGGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCATCATGAAGTGTGACGTGG
Reverse primer: GTCCGCCTAGAAGCATTTGCG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: AGCGCGGCTACAGCTTCA
Reverse primer: CGTAGCACAGCTTCTCCTTAATGTC
Probe: ATTTCCCGCTCGGCCGTGGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe: ATGCCCCCCCCATGCCATCCTGCGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: CTGGCTGCTGACCGAGG
Reverse primer: AAGGTCTCAAACATGATCTGGGT
Probe: CCTGAACCCCAAGGCCAACCG
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: GATCATTGCTCCTCCTGAGC
Reverse primer: ACTCCTGCTTGCTGATCCAC
Probe: CTCGCTGTCCACCTTCCAGCAGAT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TGAGCGCGGCTACAGCTT
Reverse primer: TCCTTAATGTCACGCACGATTT
Probe: ACCACCACGGCCGAGCGG
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TGGACATCCGCAAAGACCTG
Reverse primer: CCGATCCACACGGAGTACTT
Probe: CACCACCATGTACCCTGGCATTGCC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: GGTCATCACCATTGGCAATG
Reverse primer: CGTCACACTTCATGATGGAGTTG
Probe: ATGGAGTCCTGTGGCATCCACGAAACTAC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CGGGAAATCGTGCGTGACATTAAG
Reverse primer: TGATCTCCTTCTGCATCCTGTCGG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe: CTCTGGGTGGGTCTGTGTTGAAACA
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe: ATGCCCTCCCCCATGCCATCCTGCGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: CTGGCACCCAGCACAATG
Reverse primer: GCCGATCCACACGGAGTACT
Probe: TCAAGATCATTGCTCCTCCTGAGCGC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TTGTTACAGGAAGTCCCTTGCC
Reverse primer: ATGCTATCACCTCCCCTGTGTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe: ATGCCCTCCCCCATGCCATCCTGCGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe: ATGCCCTCCCCCATGCCATCCTGCGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TTGCCGACAGGATGCAGAAGGA
Reverse primer: AGGTGGACAGCGAGGCCAGGAT
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: CCCAGCACAATGAAGATCAAGATCAT
Reverse primer: ATCTGCTGGAAGGTGGACAGCGA
Probe: TGAGCGCAAGTACTCCGTGTGGATCGGCG
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TCCCTGGAGAAGAGCTACG
Reverse primer: GTAGTTTCGTGGATGCCACA
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GAAACTACCTTCAACTCCATC
Reverse primer: CTAGAAGCATTTGCGGTGGAC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCCTTCCTGGGCATGGAG
Reverse primer: AGGAGGAGCAATGATCTTGATCTT
Probe: CCTGTGGCATCCACGAAACTACCTTC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe: ATGCCCTCCCCCATGCCATCCTGCGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: CTGGCACCCAGCACAATG
Reverse primer: GCCGATCCACACGGAGTACT
Probe: TCAAGATCATTGCTCCTCCTGAGCGC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGCCATCCTAAAAGCCAC
Reverse primer: TCAACTGGTCTCAAGTCAGTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGCCATCCTAAAAGCCAC
Reverse primer: TCAACTGGTCTCAAGTCAGTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: AGCCTCGCCTTTGCCGA
Reverse primer: CTGGTGCCTGGGGCG
Probe: CCGCCGCCCGTCCACACCCGCC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGGAGAAAATCTGGCACCACACC
Reverse primer: GATGGGCACAGTGTGGGTGACCC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AGCCTCGCCTTTGCCGA
Reverse primer: GCGCGGCGATATCATCATC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TGGACATCCGCAAAGACCTG
Reverse primer: CCGATCCACACGGAGTACTT
Probe: CACCACCATGTACCCTGGCATTGCC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCCCTGGAGAAGAGCTACGA
Reverse primer: AGGAAGGAAGGCTGGAAGAG
Probe: CAATGAGCGGTTCCGCTGCC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TGCGTGACATTAAGGAGAAG
Reverse primer: GCTCGTAGCTCTTCTCCA
Probe: CACGGCTGCTTCCAGCTCCTC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCTGGCACCCAGCACAAT
Reverse primer: GGGCCGGACTCGTCATAC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CGGGAAATCGTGCGTGACAT
Reverse primer: GAACTTTGGGGGATGCTCGC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: GAGCTACGAGCTGCCTGACG
Reverse primer: GTAGTTTCGTGGATGCCACAG
Probe: CATCACCATTGGCAATGAGCGGTTCC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TCATGAAGTGTGACGTGGACATC
Reverse primer: CAGGAGGAGCAATGATCTTGATCT
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GAACTTTGGGGGATGCTCGC
Reverse primer: CGGGAAATCGTGCGTGACAT
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CAACTCCATCATGAAGTGTGAC
Reverse primer: GCCATGCCAATCTCATCTTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CGCCCCAGGCACCAGGGC
Reverse primer: GCTGGGGTGTTGAAGGT
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: CAGCGGAACCGCTCATTGCCAATGG
Reverse primer: TCACCCACACTGTGCCCATCTACGA
Probe: ATGCCCTCCCCCATGCCATCCTGCGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CGGGAAATCGTGCGTGACAT
Reverse primer: CTAGAAGCATTTGCGGTGGA
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTCCTGAGCGCAAGTACTCC
Reverse primer: GTCACCTTCACCGTTCCAGT
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCCTGGCACCCAGCAC
Reverse primer: GCCGATCCACACGGAGTAC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GAGCTACGAGCTGCCTGACG
Reverse primer: GTAGTTTCGTGGATGCCACAG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: ATTGCCGACAGGATGCAGAA
Reverse primer: GCTGATCCACATCTGCTGGAA
Probe: CAAGATCATTGCTCCTCCTGAGCGCA
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GGGAAATCGTGCGTGACATTAAG
Reverse primer: TGTGTTGGCGTACAGGTCTTTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TGCCATCCTAAAAGCCAC
Reverse primer: TCAACTGGTCTCAAGTCAGTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCTTGCTGATCCACATCTGC
Reverse primer: TGGACATCCGCAAAGACCTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCACCCACACTGTGCCCATCTACGA
Reverse primer: CAGCGGAACCGCTCATTGCCAATGG
Probe: ATGCCCTCCCCCATGCCATCCTGCGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TCCCTGGAGAAGAGCTACGA
Reverse primer: AGGAAGGAAGGCTGGAAGAG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: GGATGCAGAAGGAGATCACTG
Reverse primer: CGATCCACACGGAGTACTTG
Probe: CCCTGGCACCCAGCACAATG
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GCTCCTCCTGAGCGCAAG
Reverse primer: CATCTGCTGGAAGGTGGACA
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: GGATGCAGAAGGAGATCACTG
Reverse primer: CGATCCACACGGAGTACTTG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: CCCAGCACAATGAAGATCAAGATCAT
Reverse primer: ATCTGCTGGAAGGTGGACAGCGA
Probe: TGAGCGCAAGTACTCCGTGTGGATCGGCG
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CCTGGCACCCAGCACAAT
Reverse primer: GGGCCGGACTCGTCATACT
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: TCCTTCCTGGGCATGGAG
Reverse primer: AGGAGGAGCAATGATCTTGATCTT
Probe: CCTGTGGCATCCACGAAACTACCTTC
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection Taqman PCR
Forward primer: AGCGCGGCTACAGCTTCA
Reverse primer: CGTAGCACAGCTTCTCCTTAATGTC
Probe: ATTTCCCGCTCGGCCGTGGT
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: TTCCTGGGCATGGAGTC
Reverse primer: CAGGTCTTTGCGGATGTC
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATGTGGCCGAGGACTTTGATT
Reverse primer: AGTGGGGTGGCTTTTAGGATG
Probe:
Amplicon:
Annealing temperature: 60

Application: ACTB Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: AAAGACCTGTACGCCAACAC
Reverse primer: GTCATACTCCTGCTTGCTGAT
Probe:
Amplicon:
Annealing temperature: 57

ACTB news
Related resources on ACTB