ATP-binding cassette, sub-family C (CFTR/MRP), member 8 (ABCC8)

Name: ABCC8
Description: ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 11
GeneticSource: genomic
MapLocation: 11p15.1
OtherAliases: ABC36, HHF1, HI, HRINS, MRP8, PHHI, SUR, SUR1, TNDM2
OtherDesignations: ATP-binding cassette, sub-family C, member 8|sulfonylurea receptor (hyperinsulinemia)
NomenclatureSymbol: ABCC8
NomenclatureName: ATP-binding cassette, sub-family C (CFTR/MRP), member 8
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 36223
Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternative splicing of this gene has been observed; however, the transcript variants have not been fully described. [provided by RefSeq]
ChrSort: 11
ChrStart: 17414431

UniProtein db: ABCC8 UniProt protein knowledge database
Ensembl db: ABCC8 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ABCC8
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ABCC8 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTGCTAAACCGGATCATCCTAGCC
Reverse primer: CGAGGAACACAGGTGTGACATAGG
Probe:
Amplicon:
Annealing temperature: 58

Application: ABCC8 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATGAGGAAGAGGAGGAAGAG
Reverse primer: TCGATGGTGTTACAGTCAGA
Probe:
Amplicon:
Annealing temperature: 60

Application: ABCC8 Gene Expression Quantification/Detection Taqman PCR
Forward primer: CACCAATCAGCTCATGTGGTTT
Reverse primer: CCAGTACAGATCATTGTGGGTGTGAT
Probe: GGCACTGACTCCGAGTATGTAGTAGA
Amplicon:
Annealing temperature: 60

ABCC8 news
Related resources on ABCC8