ATP-binding cassette, sub-family C (CFTR/MRP), member 8 (ABCC8)
Name: ABCC8
Description: ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 11
GeneticSource: genomic
MapLocation: 11p15.1
OtherAliases: ABC36, HHF1, HI, HRINS, MRP8, PHHI, SUR, SUR1, TNDM2
OtherDesignations: ATP-binding cassette, sub-family C, member 8|sulfonylurea receptor (hyperinsulinemia)
NomenclatureSymbol: ABCC8
NomenclatureName: ATP-binding cassette, sub-family C (CFTR/MRP), member 8
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 36223
Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternative splicing of this gene has been observed; however, the transcript variants have not been fully described. [provided by RefSeq]
ChrSort: 11
ChrStart: 17414431
UniProtein db: ABCC8 UniProt protein knowledge database
Ensembl db: ABCC8 Ensembl genome database
Real-time quantitative PCR and RT-PCR primer sets for ABCC8
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.
Application: ABCC8 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: CTGCTAAACCGGATCATCCTAGCC
Reverse primer: CGAGGAACACAGGTGTGACATAGG
Probe:
Amplicon:
Annealing temperature: 58
Application: ABCC8 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATGAGGAAGAGGAGGAAGAG
Reverse primer: TCGATGGTGTTACAGTCAGA
Probe:
Amplicon:
Annealing temperature: 60
Application: ABCC8 Gene Expression Quantification/Detection Taqman PCR
Forward primer: CACCAATCAGCTCATGTGGTTT
Reverse primer: CCAGTACAGATCATTGTGGGTGTGAT
Probe: GGCACTGACTCCGAGTATGTAGTAGA
Amplicon:
Annealing temperature: 60
Complete information for ABCC8 gene (protein-coding), ATP-binding cassette, sub-family C (CFTR/MRP), member 8
OMIM: 600509 MGI: 1352629 HomoloGene: 68048 GeneCards: ABCC8 Gene ... Alternative splicing of this gene has been observed; however, the transcript variants have not been fully ...
The gene responsible (SUR1) encodes the sulfonylurea receptor, which maps to chromosome 11p15 [7]. Chemical compound and disease context of ABCC8 ...
Original Article from The New England Journal of Medicine -- Activating Mutations in the ABCC8 Gene in Neonatal Diabetes Mellitus
Mosaic Paternal Uniparental Isodisomy and an ABCC8 Gene Mutation in a Patient With Permanent Neonatal Diabetes and Hemihypertrophy. Julian P.H. Shield 1, ...
An ABCC8 Gene Mutation and Mosaic Uniparental. Isodisomy Resulting in Atypical Diffuse ... identiļ¬ed, the 39 exons of the ABCC8 gene encoding the SUR1 protein were ...
Ser1369Ala variant in sulphonylurea receptor gene ABCC8 is associated with ... that Ser1369Ala variant in ABCC8 gene can influence antidiabetic efficacy of gliclazide. ...
AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on ...
RESEARCH DESIGN AND METHODS: The KCNJ11 and ABCC8 genes and microsatellite markers on chromosome 11 were analyzed in DNA samples from the patient and his parents. ...
The KCNJ11 and ABCC8 genes encode the Kir6.2 and SUR1 subunits of the channel. Heterozygous (dominant) activating mutations in either gene can cause NDM. ...
ABCC8 gene information. Gene data. Gene name: ABCC8 (DataBase of Aberrant 3' Splice Sites) ... encoded by this gene is a member of the superfamily of ATP-binding ...
We screened the 39 exons of ABCC8 in 34 patients with permanent or transient neo ... ABCC8 gene may give rise to a monogenic form. of type 2 diabetes with ...
SNPs in the KCNJ11-ABCC8 gene locus are associated with type 2 ... gene, which extends into the ABCC8 gene, leaves. open the possibility that other variants ...
Mouse Abcc8 Chr7:53359893-53435403 bp, - strand has data for genome coordinates, ... Entrez Gene. 20927. International Mouse Knockout Project Status. Abcc8. Protein. domains ...
Ser1369Ala Variant in Sulfonylurea Receptor Gene ABCC8 Is Associated With Antidiabetic Efficacy of Gliclazide in Chinese Type 2 Diabetic Patients ...