ATP-binding cassette, sub-family A (ABC1), member 10 (ABCA10)

Name: ABCA10
Description: ATP-binding cassette, sub-family A (ABC1), member 10
Orgname: Homo sapiens
Status: 0
CurrentID: 0
Chromosome: 17
GeneticSource: genomic
MapLocation: 17q24
OtherAliases: EST698739
OtherDesignations: ATP-binding cassette A10|ATP-binding cassette sub-family A member 10|ATP-binding cassette, sub-family A, member 10
NomenclatureSymbol: ABCA10
NomenclatureName: ATP-binding cassette, sub-family A (ABC1), member 10
NomenclatureStatus: Official
TaxID: 9606
Mim:
GenomicInfo:
GeneWeight: 2366
Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. [provided by RefSeq]
ChrSort: 17
ChrStart: 67144147

UniProtein db: ABCA10 UniProt protein knowledge database
Ensembl db: ABCA10 Ensembl genome database

Real-time quantitative PCR and RT-PCR primer sets for ABCA10
PATTYN, F., SPELEMAN, F., DE PAEPE A. & VANDESOMPELE, J. (2003). RTPrimerDB: the Real-Time PCR primer and probe database. Nucleic Acids Research, 31(1): 122-123.

Application: ABCA10 Gene Expression Quantification/Detection SYBR Green I PCR
Forward primer: ATGGCTCAGATGATCCCTCCTACA
Reverse primer: CTCCGTTTGAATAAGCTCCGTGAA
Probe:
Amplicon:
Annealing temperature: 58

Application: ABCA10 Gene Expression Quantification/Detection Taqman PCR
Forward primer: ATCACAAACTGCGTTTCTCCTTT
Reverse primer: ATCGGCATGAGCAGCATCAGCGA
Probe: CAGAGGCCTGAAATCCATAACTG
Amplicon:
Annealing temperature: 60

ABCA10 news
Related resources on ABCA10