PCR primer design resources and tools
|
PCR primer design resources and tools
Links collection of free online primer design tools and resources. A very useful resource for primer design. (Andrew Kropinski, Queen's University, Canada)
Last update 06-Jun-2001, Rating Good of 1 votes.
|
Write your comment
|
how to design a primer for pBR322 Rating: Good
Reply
|
|
agctgatataaatatattttgaaccctaactatatctatatctatatatctatataattatatctatctatctatctatctatctatctatctatctatctatatatgtctatatatattgttcattttaacaacagcaca Rating: Good
Reply
|
|
I want to design a primer for ompF DNA to be used in primer extension using either isolated RNA or in vitro transcription RNA from E.coli. To design a primer where do I statrt? from + 1 or further downstream. The transcript size is around 150b. The ompF downstream sequnce is published by Norioka et al. J.Biol.Chem. (1986) 261; 17113-17119.
I would appreciate your help in this matter.
Thanking you
Nat Ramani Rating: Good
Reply
|
|
Related resource
PCR Primer Design Tools

PCR primer design and reaction optimization

Adding restriction sites to PCR primers

DNA Sequencing Primer Design Tips

PCR primers problem

Primer dimer discussion

The Quantitative PCR Primer Database (QPPD)

AutoPrime: online primer design for real-time PCR

|